ZFIN ID: ZDB-TSCRIPT-131113-4099
Transcript Name: itga11b-201
Previous Name: itga11b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056251 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056251|OTTDARG00000039186|ZDB-GENE-071009-4 itga11b|OTTDARP00000044115 itga11b-001 LG_ CU183952.17 Danio rerio protein_coding KNOWN, 4362 bp
CATTGCAGCTCCTCCTTCTACATCAAGCTCTGCTGCGCTT
CAGGACTCCATCAGAGAGCAGAGAAACTCAAACACACACA
CACACACACACACACATGCTGATGGAGTACACATACTTGC
TGCTTCTGTGGGTCAGCGCACTCATGCCAGGGCCGCGGAC
ATGCTTTAATATTGACACGAGACGTGCAAAAGTCATCAAG
GGCTCGAGAGAGGCTCAGTTTGGATATACGGTTCAGCAAC
ACGAGGCCGATGGGCAGAAATGGCTCCTCGTTGGAGCTCC
CTTTGAGACCAGCGGTGAACACCAGACAGGCGACGTCTAC
AGATGTCCACTAGAAAGCAAACGCACAAACTGCACACGAC
TGCATCTAGGAAAGATATCGCTGAACAATGTTTCGGAACG
CAGAGATAAAATGAGGTTGGGAATGACTCTGGCTACAAAC
CCAAAGGATAACAGCTTTGTGGCGTGTGGGCCGCTGTGGT
CATATGAGTGTGGAAGTTCCTACTACAGCACCGGCATCTG
TTCAAGAGTCGACAGCAACTTCAACTTCACCCATAGCATC
GCTCCAGCCTATCAGAGATGCGAGACCTACATGGACATAG
TGATTGTGTTAGACGGGTCGAACTCCATCTACCCCTGGTA
CGAGGTTCAAGATTTCCTGATCAATGTGCTACAGAAGTTT
TACATCGGTCCAGGACAGATCCAGGTAGGGGTCGTCCAGT
ATGGTGAAAGAGTCGTGAACGAATTTCGACTGGATGATTT
CCGTACAGTCGACGAGGTTGTGGCAGCAGCTAAAAATATC
GACCAGCGAGGCGGAGAGGAAACACGGACTGCTCTCGGGA
TTAATGTGGCTCGAACTCAAGCATTTAAACACGGAGGTCG
TCCAGATGCTAAAAAAGTCATGATTGTCATCACGGATGGA
GAATCGCACGACAGTCCAGACCTGAAGGCAGCCGTGGAGG
AAAGTGAGAAGGATAATATCACCCTGTACGGCATTGCGGT
TCTTGGCTACTATAATCGACGAGGGATCAATCCTGAAGCT
TTTCTGAGGGAAATCAAGTTCATCGCCACCGATCCAGACG
AGCACTTCTTCAGCGTCACAGACGAGTCTGCTCTGAAGGA
TATCGTCGACGCTCTGGGAGAGAAAATCTTCAGTTTGGAG
GGCACCAACCAGAATGGTACAGCTTTTGGTTTGCAGATGT
CTCAAGCCGGATTCTCTTCGCATATCGTAGAGGACGGGAT
ACTGGTTGGTGCAGTTGGTGCTTACGACTGGAACGGAGCG
GTTCTGAAAGAGACCCGACATGGTAAAGTCATCCCACCAA
AGTCTTCTTATATGAAAGAGTTCCCGGAGGAGCTGAAGAA
CCACGGAGCGTATCTGGGGTATATGGTGTCGTCGGTGGTC
TCTGCTCATCACGGTCAGCTGTACGTCGCTGGAGCGCCCC
GATTCAACCACACAGGGAAAGTGGTCATTTTCACTCTGAC
CAACAGCGGAAACCTCACCATACTCTATTCTCTCTACGGG
AAGCAGATCGGGTCGTATTATGGAAGTGAACTGGCACCGA
TCGACGTGGATGACGACGGATTAACGGATCTTTTACTGGT
CGGAGCTCCAATGTACTTCTATAGAGGATGGGAGAAAGGA
AAAGTTTATATCTACACCGTAGGTTTACAGGGCTCTTTTA
TACCAGATGGGACTCTTGGTCCGTCAGAACATTCCCATGA
TTCTCGGTTTGGGGCGGCCATGTCGGCTCTTCCGGATCTG
AATGGTGACGGTTTCAGCGAGCTGGTAGTCGGTGCACCAT
TGGAGGACAACCACAGAGGAGCCATTTACCTCTTCTACGG
GCTGAAAAACAGCATACAAACCAAATATAAACAGAGGATA
TCGGGCATTGAGCTGGCTCCAGGACTGCGTTATTTCGGCC
GCAGTGTTCACGGGATGATGGATCTGAATGGAGACGGGCT
CGTAGATCTGTCTGTGGGCTCTTTTGGGGCCGCAGTTCTG
CTCTGGTCTCGCAGTGTCGTCCGTGTTGGCATCGGCGTTC
ATTTTGAGCCCTCAAAAATCAACGTTTTTAATAAGGACTG
CATTCGAGGAGGTCGTGAGGTGTCGTGTATGCTGGCCACG
GTTTGCCTGAACGTCACAGCGAGGACGCCGATGACGGATC
CAAAAAGAGTCGCGCTGAGGTACAGCTTTGGTTTTGAGGA
GACTGGCTATTTCCCCCGAGCCGTGTTGGACAGCACAGAA
GAGAGCAGAGACGTCACACTGCGGCCCGCAGCGCAACACT
GCCAACAACTCCACTTCCACGTTCATGAAGTGACAGACTA
CACGCGACCTCTGACCTTCACTGTAAATGTAGGCCTGCAG
AGAGCAGATGAAGGACCGGTGCTGGACGACGGCTGGCCAA
CAAGCCTGCGGTCAGAGCTTCCTTTCTGGAACGGCTGTGA
TAATGACGATCAGTGCGTTCCCAACCTCATCCTGCAGAGC
AGCTCCGACTTGTTAGATCTCAGGGAGTTCTGCAGCCGTG
ATGAGCGCTCCTCGTGGCCGCCGTGTGTCGATCAGAGCTC
CATAAAGACCCCTGAGCGTTTGGTAGAGTCCAGCAGGAGG
AAAGTAGTGGTGGAGACGCACTTGGAGAACAGAGGAGAGA
ACGCGTACAACTCCATCCTGCACATCACACACTCTCCAAA
CCTGCACTTCTCCAGTCTGGTGGTGAAGGCACCTTCAGAC
ATTGCCATCGAGTGCCCGAACTCTGACGATACGAGTCTCT
ACCGAACCTGCAACGTCAGCGCACCATTCATGAGGGCCAG
CGCTCAGGTCTATTTTCGCCTGGAGTTTGAGTTCAGCAGA
TCTGTCTTCTTAAACTACGTCAACATCTCACTGAGGGTCT
CCAGTGAAGGTGAAGAGATGTTTCCAGAGGACAACGTCAA
TAACATTCATCATAATCTGAGATATGAGGCTGATCTTCTC
TTCACAAGAGACTCCAGTCCGTCCCGCTTTGAGATCAAAC
CTGAACAGGCTCAGAGCGTCTCTGTCGGGTCTGGACCTCC
GTTTAACCTCTCTTATCAGATCCAGAATCTTGGCCTGTTC
CCCGTCTCTGAGCTTCTCTTTACATTAAACGTCTTCGCCG
TGACCAGAAAAGCAAACACTCTTTTGCACCTCTCAGACCT
GTATATCCAGCAGATGCCGGGATCGCTCTGCAGTTTTCCA
CGTGTCATCACCGCCGGCTCCTCCTCACAGGAAGAAGATC
TTTCCCTCAATGCACACATGAACGCCTCCACCAGTGACGC
ATTATTAGCACAGTGCCGATTCAACCTGTCTCCACAAGCA
GACGTTAGCATCACCGTCACAGGATGGCTCAATCTTCACA
CTTTATTAGCCGTGAAGTTTAAGCGTTTGGATCTGGTAAT
GACGGCCACAGTTGAATTGAGCCCTTCAAACCCAATGTTT
CTCCATGAGGAACGGCCCATGAGACACATTATCCTGGAGA
TTAGAAAGGAGGAAGATTACCGGATCCCCGTCTGGGTGAT
CATCGGCAGCACTCTTGGAGGACTGCAGCTTCTGGCCCTG
CTGGTGCTGGCCCTCTGGAAGCTCGGCTTCTTCCACAGGC
AAAAGAGAAAGAGAGACGAGCAGGAAGCCAATGAGAAAAC
AGCAGAGGATCGGTAACAACATGGCAACCGCCTCAGCCAA
TCACTCAGGGACTCTCCAGATGCGGGAGTGTGTCAGCCAA
CCAGCTGCTCTGCAGCTCTCCCACAAGTCTGATGCACAAC
CAATCAGCTCGCTTGATGCGTGGCCAATTAAAAGCGAGGA
AATAAAGCAGAATTTGAATATAAGCAAAAAGATTGATAAT
GTTAACTAGTAAACGAAAAATACAGATGAATAGGCTTCAG
TTTTGAACCATAGTGAGGTTTTGGTGCTGATTAATAGTTA
CCAATATTAAAAATAATAAATAATAAATGTGTATCATGAA
ACAAACCTCAGATTGTAGACCCTCAGCATGAACTCGAGCT
GATGCACTTGCACATTGTAAAGAATTTTGAACTTGAAATT
TGTAAATACCAAAAAAAAAAGAAAAGTTCAGCAATATAAT
GTCAAACAATGGTGAAATATTTAACCGTAAAATGATTAAT
ATCGTGCACCTTAATGCATTTTATTGCTCATGACTGTTTT
GTGTATATAAAATGTGCTTTTTTATTGTATCTGGTCATAA
GTTTATATTACAGAACGAGTTTTGTTGCAGAAGATTTTAT
TCTATGTCTGTTTCTGTGTTTTATTAATTTTGTTAGGAAT
TTATTTAAAGGTTTAAGGGTAGTTGAAGTCATTCATTCAT
TTTCTTTTCGGCTTAGTCCCTTTATTACTCATGGAATGAA
CC

itga11b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA itga11b-201 4362
itga11b-202 (1) 360
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itga11b-201 Contained in:
OTHER itga11b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000056251 (1)
  • Ensembl_Trans:ENSDART00000153537 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB922077 (1) 361bp
    CITATIONS (2)