header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4098
Transcript Name: rxfp3.3b-201
Previous Name: rxfp3.3b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056248 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056248|OTTDARG00000039183|ZDB-GENE-121030-6 rxfp3.3b|OTTDARP00000044112 rxfp3.3b-001 LG_ CU183952.17 Danio rerio protein_coding KNOWN, 1212 bp
ATGCAAGTCCTCCACAGACCCGGGCTGCCCCGGGCTCCAG
ACGCCGAGCTGTTGCAGGACAGGATGGGGGACTCTCAGAA
CCAGAGCTCCGCCAACAGCTCCGACAGCCGCTTCAGCACC
CTGGAGGACATCGACCTGGCGGCGGAGGGCACCCTGCGCG
TCACGATCTCCATCGTGTACTCGGTGGTGTGCGCGGTGGG
GCTCGTGGGGAACCTGCTGGTCTTCTTCCTCATCAGAGTC
CGCCAGGGCAGGAAGAAATCCACGATTAATTACTTCATCA
TGAACCTCGCCATCACAGACTTCCAGTTCGTCCTGACTCT
GCCGTTTTGGGCTGTGGACACGGCGCTGGACTTCCACTGG
CCGTTTGGGAATGTGATGTGTAAGGTGGTGGTGACGGTGA
CCGTGATGAACGTGTACGCGAGCGCGTTTTTCCTCACCGC
GATGAGCGTGACGCGCTACTGGTCGGTGGCGTCGGCGCTG
AAGGATCGCACGCGGTATAAGCGCTGCTCGGCGCGTCTGC
TCAGCGCGCTCCTCTGGCTCCTAGCCGCCGCCGCGTCCGT
ACCCACCGCTATAGTGACCTCCGTGAAGACCATCAACGGC
GTCAAGCTGTGCCTGCAGCGCTTTCCCAACGACCAGAACT
GGCACGCGATCTACCACCTGCAGAAGATCCTGGTGGGCTT
CGTGATCCCGATGCTGATCACGGTGGTCTGTTACGCGCTG
CTGCTGCGCCTCATCCGCCGGCGGAGCATGAACAACAACC
TGCCCAAGCGCAGATCCAGAGTCACCAAATCCGTCACCAT
CGTGGTGCTCTCCTTCTTCATCTGCTGGCTGCCCAACCAC
GCCATCACCTTCTGGGGAGTGCTGGTTAAACTCAACGTGA
TCCACTGGGATAAGGTGTTCTACATGCTGCACACCTACGT
GTTCCCGGTGACCGTGTGCCTGGCGCACTCCAACAGCTGC
CTGAACCCGGTGCTGTACTGCCTCATGCGCAGGGAGTTCA
GGAAGATGCTGAAGGATTTCTTCTGGAGGATTTCCTCTCC
CGCGATCGCCAACAGCTGCCAGATCCGCCCGTTCTCCGGC
ACCGCGAAGGAGCGCGAGGACAGCCAGGCGGCGATCCCGC
TGCACGTGCTGGAGACCGAGGAGTACCGGCTGTCGGTGGC
GAACGTGCAAACCGACGCGCTGCCCTCCACAGACTGCACC
ATTCAGAGGTAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rxfp3.3b-201 Contained in:
OTHER rxfp3.3b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000056248 (1)
  • Ensembl_Trans:ENSDART00000155229 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI890967 (1) 652bp
    CITATIONS (2)