ZFIN ID: ZDB-TSCRIPT-131113-407
Transcript Name: pik3r6-001
Previous Name: dkeyp-21h4.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053377 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053377|OTTDARG00000037410|ZDB-GENE-120524-1 pik3r6|OTTDARP00000041994 DKEYP-21H4.5-001 LG_none BX120006.15,FP101990.4 Danio rerio protein_coding PUTATIVE, 2669 bp
GCAGACATGAAGGAGCTTTCTAACTGACTCATCAATGTCA
TGTGGATTTTATCTGAGCTGTGAACCCCACCATGGAAGAA
ACATTCGGTGGTGTATCACCAGTTGTGGTTTCTAGTCTCT
ACCACAATATCTACTCCATCCTCAGAGAACTGGACTGTAA
ACCCCAAGCGGGATCCGCCTCCAATAAAGGCATGTTGAGA
TGGACTCTTCATAACCGGGTGGACAGAAATCCATCTATCA
GTGTCCCTTTGGTCAGGGTTCTGATAAAAGAGCTTGAAAA
GGCGGAGAGAATCGATTCCAAGATTCGCATCATTCCTTTA
CTTCACACACTTGTCTACACAGTCCTGCAGTCTGTATTTA
TTCCTGAAGACCTCTATCGAAGGATATATTTATGCCTGAA
ACGTTTAGTTCTGTTACCTGCACCATACTGTGCAATCGCA
CTTGACTATGCAAGACAGATGAAAATGGAGCAAAGTGCAC
CAGGATTACTGTATCAGCGGAGAGTCATTGCTGAACACAA
CCTATGTAATGATCTTTATCCCCTCCATGAGAAGGTGTTT
GTGTTCGTAGATCCTGCTGTGTTTCCTCTGTCTCTGGTAA
ACGCGCTCAAAGCTGAGGTGGAATGCGGGAATCCTGCTGG
GGACCCACTGATGTACAAACGCAGAATTTTACTGCACACG
ATGCTGGCTGGGTTAGGAAAACAGTGCCAGGTAGACAGGC
TCACACAGGCTCTAGAGCATTCAGGTGAAGACATAGAGCT
GTACTTCCAGGATCTAGTCACCATCTTAGAGCAGAGAGCA
GAAGATGGAGCTTCAGATGATAACCAGTACAACATAAGGT
TACAAGAGATCTACCAAGACATCCTGAGTCCAGCCAAAGA
TCCATCATGTCAAGCATCTCAAGTGGAAACTCAGCTGCCC
GGTCCTGAGGTCAGCTTCCACGTGTGGACCAAAGAGGATG
AGATATGGAATGAGCTGGTTAACTATGCCCTGATGGTTCC
TGCCGACCGAAGCTCTGCTTACCTGGACCAGGACGATCTA
AAGCGTACCTCTGTCATGTCAACCGTGTCCACAGACAGTG
GCATAGAGGGAGACATGCCCATCAGTGAGCTTTCCTCTCT
GATGATGGACTTTCAGAGCGGTTCAGATGACCAGAGCAGA
TCCCTGTCTTTCTACAGGAGGCCGTGTGTGCGGTGGCCCA
AATCAGGCAACAGAATGACGCTCATGATGGAGGCCATCAA
GGGCAGTGGAGGATGTTCCCTCACTAAAGAGGAAAGAAAC
CTGACGGCTCGCATTGTTGTATTGGGCGATGACAGAACGT
TGGGACGGCTAGCTAAGACTCTCTACACTATACGGAAAAG
GGAGGCACGACATCTGCTGCTAACAAAGAGAGTGAATATG
GAGATGTATTACATTCCAGTGACTGACCAGCCACCTTTAG
TTCAGGAGGGTGTTCCTGAAGACATGCTGACACTAGCAGG
ATATTTGGGAAGTGTGGATCCCTGGTATGACAGTAACATC
AATGGCTTAGGGGCCATGATTCTGAAACTGGCACAAATGC
AGTCAAGTCAGAGCGAATCTTCACAACCCAACACCTTCCT
GCTAGATATCATCTCATACTACACACGAGTCAGCCAGCAT
CCGCTGCATCTTCCCATCTACTCTGTCAAGATCTGCTTCT
CTGGGCTCAGTTCACCCTCAGTAGAGGAAGTGTTTGTGGC
TCAGCTCATGATGGACTTCCCCGAGGTCAAACACTACAGA
GCCACATTTAAAGACACCATCAAAGGTTCAGTGCGTCACA
GAAAATATAACCCTCAAGAATATCAGGGTACTGTTGTGTC
AATTAATTACAGAAAGGCCTCAATAAGTGACAGAGAAAAG
GAAAAGGGAATGTCTTTGACCACAAACGGCATGATGATCA
GTGTTTTGCCTTCCTGCAGAGTCAAAAGTCTACATAGTCT
CAACATAAGTTTCCAAGATATGAATCCCTTAAGGCCAAGC
AAACCTTCAATCAGAGCTGTTAGCGTCAATATCAGAGTTC
TGGAGAAGCAGACATTCACAGTTTGTCTGGATAAAGACCC
ACAAAAAACATTCAAGAAAGTCCAGAGTATTGAAGTTTCT
CCATGCTTGGATCCGGGATACTGCCAACAAGCGAGTACTA
AGTCCAAGTACAGTTTGGGAGAAGGAGGAGAATCACTAAA
TAAATACCTGAATAAAACTCTCACGCTACCAATCAACACC
TTCTGTGGCTCCGAACAATGACATTATGACTTGTTTTCTA
TGACACAAGCACTTGAGTCAGAAGACAAACTGAAACTTGA
CTCCACTCGGTAGCTTTTAGTGTGTTTTATGTGTGTTCAT
TTCCTCTTTTAATCTCTTAAAATACATGTAACCTCGAGAG
GCCATGGCTTCCTGTTGAACTGTGAACAGACACGCTGGTA
AGCCTGAGACTGTTTGAATGTGCATATTATCTGTCTGAAG
ATTGACCTTGATCTAAAGGGCATGATTGTGATCTTGATCT
AAATCAATTTCAACATCCTGCAGTATGCACAAAACACAAA
AACAAAACATGTTTACACTACTTTTATGACAGTACTGTGT
TTGTATGATACTTGGACATAAACACTTTGTAAGCATTATG
ATGTTCATTTGATGCTTACCATTTATAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pik3r6-001 Contained in:
OTHER pik3r6-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053377 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DR723126 (1) 779bp
    CITATIONS (1)