ZFIN ID: ZDB-TSCRIPT-131113-3956
Transcript Name: arhgap5-203
Previous Name: arhgap5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055637 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055637|OTTDARG00000038793|ZDB-GENE-081014-1 arhgap5|OTTDARP00000043630 arhgap5-001 LG_ BX950192.10 Danio rerio protein_coding KNOWN, 5837 bp
GATGACTCTCCGGTTACACGCATACCACTCTTACTGCTGA
AAAACACACAAAACAAACACTTTCGTGGATTTTCGACCAT
TAACCCAACAATTTTCTGTAAACTCGACCAAACTGGAATT
AGTTTTGGGATCGCATCCGTGGAAATTAAAGGAAATAGTT
GGAATGCCACCTCCTGTCTGTGGTGTCGGGAGCTGGGAGC
GACCATGTTAGGAAGGTGATAAGAGGACAAAAAAAGGAGT
CATTCGGGACAGATGATCTAAATCAAAGCTACATCGGCTT
TTTCAAAAGTGAGACATGAAAATGTGCCTGCACTAACAAA
TGGAAGTACGTGCTTGCCTTGCCGGCATACTTCGCTTAGC
ATAACAAGCAATGAGAGGGGCAATATAATGGCCAAGAATA
AGGAGACCCGTCCGACATATGCTGTCAGTGTCGTCGGGCT
CTCAGGCACTGAAAAGGAAAAAGGTAACTGTGGTGTAGGT
AAATCCTGCCTATGCAACAGATATGTGCGCCCCAGCGCGG
ACTGCTACTACTTAGAGCACACTTCTGTGTTGAGCACAAT
TGACTTTGGAGGGCGTGTAGTGAATAATGATCACTTCTTG
TACTGGGGTGAAGTGTTGCATCGAGGGGATGATGGTGTCG
AGTGTAGGATTCAGGTCATCGAGCAGACAGAGTTCATTGA
TGATCAGACCTTCTTGCCTCATCGGAGCACAAACTTGCAG
CCTTACACAAAACGGGCGGCGAATACGAAGCTTCAGTCTG
CTGAGAAGCTGATGTACATTTGCACAGACCAACTTGGGTT
GGAACAGGATTTTGATCAGAAGCAGATGCCCGATGGCAAG
CTTAACATTGATGGCTTTGTATTGTGTATAGACATAAGCA
AAGGATGCAATAGAAAATTTGACGATCAGATGAAATTTGT
CCACAGTCTTTATTCTCAAATTTCCAAGGCTAAAAAGCCT
ATTATCATTGCTGCAACAAAATGTGACGAGTGTGTTGAGC
AATACCTAAGGGAGGTCCAGACGTTTGTTACAGGTAAGAA
GAATCTAATGTTGGTGGAAACATCTGCACGAGCATCTGTG
AATGTGGAACTCTGTTTCAATGCTCTGACACAGCAAATAG
ACAAAACCAGAGGTAAACCCAAAATCATCTCTTATTTGGA
AGCGTACAAATCCCAGAGACAATTAGTAGCTTCAGTCTCA
GACAAGTTTGAAAAGCTCATCGTTCAAACTGTCCGAGATT
ATCACACAAGCTGGAAAATTGTGAGCAATAAGTTAAAAAG
CCACCCAGATTATGAGGAGTACATCAATTTAGAAGGCACC
AAAAAGGCCCGAAACACTTTTTCAAAGCACATAGAGCAGC
TGAGACAAGAGCATATCAAGAGGCGGCGTGAGGATTATCT
TACCAGCCTGCCAAAAATTTTTAATAAGTTGCTTAACAAC
CTGGAGGAAATTGAGACGATGAGTTGGACTGAGGCTCAGA
GCCTTATGAGGAGCAGGCATGAATTTCAATACTGTTTCAT
TGAGTTAGAGCACACGCCGTGGTATGAGACAGACCACCTT
GATAAAACCGACGACAGAAGAGTGCCCTTCGATATCCTCC
AAACCATGCAAGGAGAGAGGATTTATCAAAACCATGTCCA
GCATTTGATATCTGAGAAGAGGCGGCTGGAGATGAAGGAG
AAATTTAAGAAGACGCTGGAGCGAGTGCATTTCATTAGCC
CTGGCCAACCGTGGGAAGAGGTCATGTGCTTTGTCATGGA
GGATGAGGCGTACAAGTACATCACTGAATCAGATCGCAGA
GATGTTTACAGTCGGCATCAGCAGGAAATAGTTGAAAGGG
CCAAAGAGGAGTTTCAGGAAATGCTTTTTGAACACGCAGA
GCTGTTCTATGACCTCGATCTAAATGCAACCCCGAGCTAT
GACAAAATGAGCGAGATTCATGCCGTACTTAATGAGGAGC
CAAGATACAGGGCTCTCCAAAAACTAGCCACAGACAGGGA
GTCCCTTTTGCTGAAACACATTGGGTTTGTCTATCACCCC
ACAAAAGAAACATGCCTCAGTGGCACGGCCTGCATCGATC
TCAAAGTAGAGCAAGTCCTGGCCAACCGTCTAGTTCAGCT
GGATCACGGCCGCTCAAATATCTACTACAACAGTGCCAAC
ATTGAGAAGGTTAACTTATGTCTTGTGGGTAGAGAAGGAC
TGGCACAGGAGCTTGCAAATGAAATCCGAGCTCAGTCCAC
TGATGATGAATACACTCTTGATGGGAAAATATATGAATTA
GACCTTTTGCCTGTGGATGTCAATTCCGGCATGCTTTTGA
ACCATTCCTGGATATCGACTTTCAAGCCCCATGGGTTCTT
TTGTGTCTTCAGCTCTATAGAGTCGCTTAATTACATTGGT
GACCGCGTAAGCCGGATCCGAGCAGAGATTGCCCAGAGCA
GAAGGGATAGGTATAGCCAGCCAGTGCCATTCATTCTCAT
TCTAGCAAATCAGCGTGACAGTGTTTGCAAAAACATGCCT
ATTTTGAGGCATCAGGGCCAACAGCTTGCAAATAAGCTAC
AGTGTACTTTTGTAGATATACCCACCGGCACTTTTCCCAG
GAAGTTTAATGAGTCTCAGATAAAACAGGCCCTCAGAGCT
GTGCTGGAGGGATTGAAGCACAATTTCGACATGATGAGCC
CCATGCCCTCCATCAAGGATCTGTCTGAGACGGATTTGCG
GATTGTCATGTGTGCCATGTGTGGAGACCCGTTCAGCGTG
GATCTCATTCTCTCACCATTCCTGGACTCCCATTCCTGTA
GTGCCGGACAGCCCGGGCAGTGCAACACATTGATCCTTGA
CAAAATCATCGGCAACGGCCGCAGGCGCATACAGGTCACG
GTGCTCTCTTACCACTCCTCCATTGGAATCAGAAAGGATG
AATTGGTGCATGGGTACATTCTAGTTTACTCAGCAAAAAG
AAAGTCTTCCATGGCTATGCTGAGGGCGTTCCTGGCGGAA
GTCCAGGATGTCATTCCAGTTCAGCTGGTGGCCATTACGG
ACAGCCAAGCAGACTTTTTTGAGAATGAGGCGATAAAAGA
ACTGATGACTGAAGGGGAGCACATTGCCACTGAAATTGCT
GCTAAGTTTACAGCTCTCTACTCCTTGTCCCAGTATCACA
GGCAGACTGAAGTTTTCACACCGTTTTTTAATGAGGTTCT
TGAGAAGAAGAGCAACATAGAAAGCTCCTTCATGTTCGAC
AACAGCAGGGACGGAACTGGCACCACCGAAGATGTCTTCC
CGCAGTCACCCCATAGCCATTCGCCCGCTTACCAATACTA
CCCTGACTCTGAGGATGATGGAGAGGGGCCACCACCCTAC
AGCCCGATAGGAGATGATGTGCAGCTCCTGCCCAATCCTA
GTGAACGGAAATACAGGATTGACCTTGAAGGAAATGAGTA
CCCAATTCACAGCACACCTGTTGGAGAACACGAGCGTAAC
CACAAAGTGCCTCCCCCGGTAAAACCCAAGCCCAATGTGC
TGCCCAAACCCAATGTTAAGAAGCTGGACCCCAACCTTCT
GAGGACCATCGAGGCTGGAATGAGGACCTCCAGGTGGACA
CGAGGTCCAATGATGGGTCACAGTGATGACCTTGAAGCAT
CTGACAACTATGCAGAGCCAGCAGACACTCTCCAACACAA
ATCAAAAGGCTACAGCGATGATATTTATGCTGTACCAGAA
GATGCACACAGCAGATCTGGCAAGACCCGCAACTCTTTCG
GCGGACTAGTTGTGCATGTGGATGAGGAGAACGGCTTTGA
TTCCATGTCTAAGTCTCAGGGTGGCAGAAGGCCTTCTAAG
TATAAACATCGTTCCAAGATCCTCTTCAGCAAGACAAAAG
CTTATCATAGACGAGTGCACTCTGATGTCAGTGATGATGA
GTCGGGGCCTGCCACACAGAAGAAGAAGAAAGGAAGGGGC
AACCGAGGCAGTGAAGAAGACCCGCTTCTCTCACCAGTGG
ATCCTTGGAAAGGAGGGATAGATAATCCAGCCATCACATC
GGACCCAGAGCAGGATGAAAGGAAAACGAAGAAAAAGAAA
GCACCAAAGACCAAGGAACCCAAAAAGCCCACAAGGTCAA
CAAAGACCACAAAGCCATTGTACCCACCAACTCGAAGAAA
TTGGGAGAGCAACTATTTTGGGGTGCCTCTACAAAACTTG
GTCACTCCTGATAGACCCATACCTTTATTCGTTGAGAAGT
GTGTTGACTACATAGAGCGAACAGGTTTCACCACAGAGGG
CCTTTATCGAGTGTGTGGAAACAAGACGGATCAAGACAAT
ATTCAGAAACAATTCGACCAGGACCACAGTATTGACCTGA
TAGTAATGGATGTGGCTGTGAACGCCGTGGCTGGGGCTCT
GAAGGCCTTCTTTGCTGATCTCCCGGACCCGCTCATACCA
TACTCTCTTCACCCAGAGCTCGTGGAAGCAGCCAAAATTG
TAGATCATTACGAGAGACTGCAGGTGCTGAAGGAAATCGT
CAGAAAATTTCCTCCTGTGAATTATGAAGTTTTCAAATAT
GTCATCACTCACCTCAACAGGGTTAGTCAGCATAGCAAGA
CCACATTGATGACCGCCGACAATCTCTCCATCTGTTTCTG
GCCGACGCTCATGAGGCCTGATTTCGAGAACAAGGACACG
CTGTCCACCACCAAACTCAACCAGTCGGTCATCGAGAGCT
TCATCCAGCAGTGCCAGTATTTCTTCTATGGCGGAGACAT
GACCGAACCGTCCAGTGCTGAGGGCACACCTCCACCCCAC
GGCCACGGCCTGGAGTCTTTGCTGGCCCTACAGCTCCCGC
CACCCCTCCAACCACAGCAGATCCAGCACCCGCTGCCCCC
GGAACCCCTCATATAGACCTCCTCATCACATTCGGCTGAT
TGCAAAATGCTTGTACAAGTATGTGTGGGTGTGTATGTGT
GCGTATGTGTGCGTGTGTGTGTGCGCAAGCCTCGAAAAAT
AAGAAATGAAACTTTTTTTTTTTGTACAAAGAAAAATATG
AAACATTTCCCCCACCCCCGTTTTTTTTGTGGCCCGGCCT
GACTGAATGAGAGTGAATCAAAACTGTAAAATCAAATTGT
AAAGAAGATGTCAATGTAAATTTGACATCGTAAATGTGAC
AAACATCGAAAACATAAGATTTATTTATAATTTTTTTGTT
TTGTTTCAAAAGACAATGAAGTCAATCATTTACTATGAAA
ATACACACACATGCACAGCTTGACATGATGGCAAATTGTG
CCCCCCCCTTTTTTTTGGCTTGTGTTTGTCCCTGTTTTAA
TTTCCAATGGACAAAAGATCTATTTTTTTGAATATTTTTA
TCTTAAAGACAGCAGTCGTCGTTAGGGTGGTGGTGTCCCA
AGGAGTTTGGGATTGGACTAATATGAGTTTATAAAATCAG
GGGCGCCTGCATAGGATGCACTTTGTCCTACAGATGTTGA
ACCGGGAGCCCCTCGTACTCTGGAAACCACAGAAAGGGAA
ACAGGCCCACTGCAACCGTTTGGCACATCTCAGAGATCCA
GGCTTCAGAAGATGCCCGGTTTTCTCCATCTCGTTTCATG
TTCGTTTGTTTCGTTCCGTATACCACCTTTGAAAGTTTTA
TTGTTGTCAATTAATTTTTTGGACTGAATTTGCATGTTCT
TTGCCACTTGTAATAACCGAAAGAGTAAACGCGGAGGAAA
AGCATAAATGCTTAAATGTTTTTATTTTTATTTTATTTTT
TTTATGAACGACTTTTTGATTACCTTTTTTTTTATCTAAC
TTGTTTGAGGGAACATTAAACTGGGGTAAAATTGTTA

arhgap5 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA arhgap5-202 (1) 821
arhgap5-203 5837
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arhgap5-203 Contained in:
OTHER arhgap5-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055637 (1)
  • Ensembl_Trans:ENSDART00000156180 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT591010 (1) 814bp
    GenBank:CT734273 (1) 804bp
    GenBank:CT646519 (1) 799bp
    GenBank:DT072027 (1) 780bp
    GenBank:EB894812 (1) 626bp
    CITATIONS (2)