ZFIN ID: ZDB-TSCRIPT-131113-3798
Transcript Name: sfi1-202
Previous Names: sfi1-001, ch211-13j1.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055058 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055058|OTTDARG00000038430|ZDB-GENE-080206-4 sfi1|OTTDARP00000043180 CH211-13J1.4-001 LG_ CR293534.5 Danio rerio protein_coding NOVEL, 5364 bp
TCAACTCACCTGATATTTGAAACGGTGTCACAGCACCTTC
TCTGTCCCCGCCGGGTTACCTCAGTTAGCTAGCTTCTGGC
TACCTGTCTTATACCAAACTACAAGAAATGCCGGAGTCAG
TCCAGAATTCAGAAAGGACGCGGATGAAGTTTCCTGCATA
AAAATAAAGTTTCTCTATCGACGGTGTTGAAGGGGGTTCA
GATATCGCTTGTCACTCCAGGTGGAATCGTTAATTGACAG
AGAGGAGCATCTCATTAGCAAACTGGCTACACTTATCAAG
CCGACGCCGAGGATTTATTTAGGTTCTTACAGACGAACGA
CTATTTGTCCAGACTTTAATTGTACCTTTGGTTTATTTCT
CCTTTGGGTTTTTTCGTGGGAGCGATAAACATGGAAAAAC
GCCGTGTTTGTTTGTTTATTTATAGGCTAGTGAGCCAGGT
TAGCGGGCTAGGAAACTTATCCACACTCATAAATCTGAAC
AGCGCAGGTCTAAAGCGCGCTAGTAAATTAAAGCTCACGT
ATATTAGGAATAAATCGGGCGGAAATTTTGGTTCGACGAC
TTAATTAAAGCTTGTATTCCGGCTTCTACCATCAATGTAC
CTCGGGGTACTTTCTCAGAGCTCTCTCTTTCGTCTCTGTT
CAGTCGCAGAGCGGCGAATTTCTTCAGATCTCTGACTGGT
TCTGAGAAAGGCCCCAATCAAGGATTATATAGCTTCTAAT
CACGCCTTCTCTAAAGTTTTACGAAACTAGGTCTTATTTT
TGATGAAGATTTCAAATGTTACAATACAGAATGTGAAATT
ATGAGGTTAGAAGTGTGTATTTTATACAACGCTGTTTACA
AGAGGCGTTAAAGAATTTTGAACACGAATATGTTTCAGGC
ATTCAACGCGGCCACCCTTTATAAATTGTAGTCACGTGAC
AGGATCTAACACGCTCAGTTAAGTTTTTTTTATTCAGGTT
GAGTTTGTTTTTGTTGGTTGGTTTACAGGATTTTGAGCAA
AACTAAGAGCTTTTTATGAAGAGATTATATTTAGTTAAAA
GCGTTTTATACATGTTCAAAGGCATGACGTTTTATACATG
TTCAAAGGCATAAGTAAAATATCAATTGCTCTTTATAAAG
TCTGCATCGATAATAGGAATAATAGTAATGCTATTAATAT
TAATAACACATTATTTTGAAATAAAATTATTACATTTTAA
AAAGTAAAATTGTATTTTTACATCATACAACAGAATTTTT
AAACATACGTTTAATAATTTAACCTACATTTTTAAACTGT
TATTTTTAATGAGGCCTTTGAAAAAACTTTTATTTTGACA
TTGTTTACCGGAAGAATGTTCTTTTAACTCAGAAGAGCGG
CAGTTATGTTTTGTTGTTGATACTAGTTGTCAGAATGATG
ACACCTATTTACCGAGCTACAACATGTCTTAGCCGTTAAG
TGAAAACTTAAATGACTTTATCTTTACTTTAATTATAGTT
CAGGTTACGTTACCTGCAGGAAGATTGCGCGGCGATGGAC
TAAAGGTTATGTGTCTAAAGTAACGTTACAGCGTTTAAAA
TGCAAACGACAAGACCACACGCTGGGAAACAGCTGTCGTG
TGCTGTTGAAAAGAACCGGGCACGGAAGACAGTAACACGC
AAAAACACTTACCGGGTCGGATATACTTGGAACCGAGGTG
GTAGACTTAAAGAGCTGAGGATACGGCACCTTGCTCGAAA
GTTCCTTTTCTTGTGGATTAGGAGGACATTTGGACGAAAA
ACAACATCACAAGCCAGATCTCATTATTGTAAGGTCATCC
TGAAGAAGGTCTTCAGGTCTTGGAAAGATGAATGGTGGCA
TTCAAGAAAGGAATGGACTCTCAATATAAGGGCCGACTGC
CATTATGCGTATACAGTGTACAGCAAAACATTTCAAGCCT
TGCAGGAATATGTTGCTGTCCAGAGGGAAGAAAAGAAGAA
ACTACAGCTTGCGATCACTTTTGAGACGGAGCACAAGCTG
CGCTGTGTGTGGAATAGCTGGGAGCTTTACCTGGACATGT
GTCGCATGAAACGCAGGATGCAAGAGGCAGCAGTACAGCA
CAAGAATCTCACTGTGCAAAAATGGGTTTGGACTGTATGG
AACTTGGCACTACAGCACAGAAAATTGGAGTACCACCAAC
AAGATCTTGGCTTGCAACATTGGGCACACAGTGTACAGAG
CAGAGCATGGCTGCACTGGAGGGACCGGATGAAACATGCC
TGTGCTCTAAAAGAGAAAGAGTCCAAAGCTCATCATCACT
ATTGTCTTCAACTGTTAAAGCAAACGCTGCATGGTTGGAT
CAGACATGCAGAAAACAGACAGGCTAAGAACAAGAAAATA
GCTGTTGCTCAGGATGTGCGGCGTCTCTCTGTGCTGGAGA
GGTTTTGGTGGCAGTGGTTTGAAGTCCTGCAATCCAGACG
TGTTGAGAAAGACAGAGGACAGAGAGCAGACAAACTGGCC
CAGCACGGCTCCCAGCGGCTGGTCTTCTCCCACTGGAGAC
ACTATGTCAGTATATGCTCACAGAAGGCTAAGAGGGAAAA
GAGTGCCATGCATCACAGACAACGTTATCTTCTGCATTTG
GGACTCAAAGGCTTTGCGCTAAATGTCACTCAAAGTAAGA
CTTATCGTCTCAACAAGAACATTAGTGTTCAGCATCGTCA
TCAGAATTTGCTGGCAATGTGCTGGAATGTCTGGCAGTTG
CGTTTGGATCGGGAAGAGAACAGACGTCTGCAGCCCCAGA
TGAGTGTTGCACAAAACCATCACAAATTTTCTGTGCTGAG
ATTTAACCTTCATCATTGGAAAAAACGTCTTGCAGAGCAC
AAAAAATGTCAGGAACTGGAACTACGTGCTGATGCCTGCT
TTGCCCAGCGTATATTCCCACAATGTGTAAACACTTGGAT
GGAGTTTACAGCACAACGCACAGAGAAACGAGAGCAGAAA
GAGCGAGCTGAACAGCAGTATAGGCAGCAGACCTTTAGTT
GGGTATTTTATACTTGGTGGAGAAACCTGGAGGCAAGGAG
GGATCGGAGACTTGCTGAAAGAACTGCGGTGTTGCATGCT
GAGCATGTGTGTTATGTTCGTGTCTGGTCTAAGTGGTACA
GTGGTGCTGTTCAGCGCAGAGAGGAGAGAATTAAACAGGC
TGTAGCCGACTCACTGTACAAACACACTCTGCAACAGAAG
AACCTGAACCACTGGAAAAATCGTTTCATAAACATACAGA
CCAGTCAGAAGCGTTTTAAGCAGGCAGAGGGTCATCATGA
ACAGAGATGTCTGAAAAGAGCCATGACAGACTGGCATCAG
TATGTTGATCACAGAAGACTGAAGAAAGAGAAGATTGCAG
AAATGGAGAAACATTACCACAACAAATTGCTCAAACATGC
TCTTGATGCTTGGAAGTCATACCATTTGCAGACACAGGCA
ATCAGCCAACTGGTAGAGTACAGTTACCAGGAGCATGAGC
AGCATCTGGTCAGGAGAATGTTCTGTTTATGGAGGATAAA
CGTGTTACAGTTGGTGGAAGAGAGAGAAAAGGAAAACAGA
GCAACATGTTTGTCTCAAAAGCACCTTGTATCCCAGGTGT
TTCTTGCATGGCAACAGAGAACTGTATCTGCACACCTTCA
CCGTCACAAAAAGAACGAAGCCCTCAAACAAGCCCAAACA
CAACTGGAGAAATTACGCATACAAGTGGCTTTGAGAAAAT
GGAAAGAGCGAAGCATTGAAGTGAAGGATGAGAGATTGGC
AAGCGAGAGGGCCGACAGACATTACAGCAGAACACTGAGG
GAGAAAACTCTCAGCAATTGGACCAGCTTTATTCACCATC
ATAAAATATATCAGGTGATGAAGAAAAGAAGCTTTGAACT
TCACAAATTAAGGACTTGTCAGCACTTTTTTATCTGCTGG
AAGACACAGCTGCAGAGCAGAAGACGAGAGGCGGAGCAAA
CTGAGACTGCTCTTTGGCATTGGTCCCTCAACCTACAGGC
CAAGGTGTTCTGCATGTGGCGGATCTGGATTGCAGAGCGT
CAGAGGAAACAGAAGCGTTTGACTGAGGCAGCTCAGTTTT
ATAGAGATGAACTGTTGCGAGAGGGCGTCACACACATCCT
TACACACACGGCACATATGAATGCTTTCTCCACTAATATT
GCCCAGCACAGCTATGAACAGAGCTGTCGTCAGCTTCAGG
AGGTGGTGAGGCGATGCGCTCTTCGATGGAAGCAGCGTGC
GCTATGCAAACCTGTCAAGGATAAATCTACACCGTCTAAA
GACAGTCAAGCCAAGAAAAGTGTGTCTTTTTTTCTGCCAG
GAGACCCCATGCCCACCCTCTGTCCAGGCAGGATCCAATC
ACCAGAGCAGAGGCAGAAAGATTCTGTCATTCATCAGATG
TGGTCAGTTCGAGCATCTAGACCACAACCAAGGAGACCAG
GTGACCTTCTGGAGTCCCCAGCCAAACATCTGTCACGTGA
CCTTAAGATCAGCAGGGGTCAGAGGGTGTTTGTTTCAGAG
ACTGCATTTCCATCAGTCCCTTCTACCTTTCCTTCACCAC
TGCCCTCAGTGCCTTTGACCCACAACCCTCTGAATTCACC
TGCAATGGTGCTACAGCCTAAAACGCTCCTCCTCAAACCT
GACTCTCCAGGATGTATCGCCACTACCAGCCAGGACATAC
TGCTTCCTCCATCCACATTCACTCTCTCAACAGCGCATAG
CAAGCAAAAATACTTGAGAGATGGTGGGCCACTACTGCAT
TCCAGTCATTTCACTTCCCGATTTTTCCCAACACACGCTT
TAGGTTTACATGAGAGAATACCAGAGGATGAAGAAGAGGA
TGTGGATGTGGAGCAAACTGAAAATCTCACCAAAGAACTA
CTAGATATTAGACTGGAGATGCAACGATACCAGCAAGACA
GAAAACAGCTACAGACATGGCGCAAGCTTCAAAAGGTCTT
GGGTAACTGGCTTGAAACGACAGGCACTGAGGGGGAAACT
GATGAAAGAGACAGCATCTTAAAGGAGTTAACTGAGCTAG
AGAGTCGGATTTCTTCTCTATCTATGAGAATAAAAAAGCA
GAAACCCTCCATGATTCGCCATGCTGCCAGAGTTAACACT
ATCCAGAGCCAACTACTACCATCTGAGGGCACCACAAACC
TACCTACTGAGTATGGAATATAAACCAATATTGTACAACA
AATAAACTGAAGTTTATTATTCCACAAACAATTATACCTC
CTATCCTGTTTTGGTATCAGTGGGAAAAGCCAAGGTTTTG
ACTTTATTGCATTTCTTGCTATTTATTGAAAGACGTTGTA
AATGTGTAACCTATGTAATTTTTAATAAAGCATTAAATCA
CGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sfi1-202 Contained in:
OTHER sfi1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055058 (1)
  • Ensembl_Trans:ENSDART00000155363 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC154764 (1) 2871bp
    GenBank:CK015797 (1) 831bp
    GenBank:DY544960 (1) 736bp
    GenBank:AW826518 (1) 465bp
    GenBank:CT735671 (1) 390bp
    GenBank:EB789343 (1) 358bp
    GenBank:BE016060 (1) 300bp
    CITATIONS (2)