header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-3776
Transcript Name: oxtrl-201
Previous Names: oxtrl-001, dkey-66f12.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054983 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054983|OTTDARG00000038377|ZDB-GENE-110805-1 oxtrl|OTTDARP00000043129 DKEY-66F12.3-001 LG_ BX649305.9 Danio rerio protein_coding NOVEL, 1532 bp
TGCAGTGAACTGGAGCTATCCTCAACGTATGGTGCTAATA
ATAACTGAATGATTTCACTCATGTGTAATGATATTTAGCG
AGTGAGAGCGGCGCTGGGACGCGCTTTTTTACGCACAATG
GAGAGCCTGCTAAAAGACGTGATCCTCTGGCCCATTAACG
ACTCCTGGGCCAACTCAAGTAGGGGAAACGACAGCAGAGG
ATTGAACCAAACTGTGAACCCCCTGAAGCGCAACGAAGAA
GTTGCTAAAGTCGAAGTCACGGTGCTGGTGTTGATTCTGC
TGCTGGCGCTCGCCGGAAACCTGTGCGTCCTTGTGGCCAT
CCAGACGAGTAAACACGGCCAGTCGAGGATGTATTACTTT
ATGAAACACTTGAGCATTGCTGACCTGGTGGTGGCGGTTT
TTCAAGTCCTCCCCCAACTCATTTGGGACATCACCTTTCG
CTTTTATGGACCAGACTTTCTGTGTCGTTTAGTGAAGTAC
CTACAGGTGGTTGGCATGTTCGCGTCCACTTACATGCTTG
TGCTGATGTCCATCGACAGATGTTTGGCTATCTGGCAGCC
TCTCCGTTCCCTGCGCCGTCGAAAGGACCGTTTTTACGTA
TTGGCCTCTTGGATTATAAGCCTGCTGTTCAGTTTGCCGC
AGGTGTATATTTTCTCTCTTCGAGAAGTTGGCGATGGGGT
GTTCGACTGCTGGGGGGATTTTGTTCAGCCCTGGGGCGCG
AAGGCTTACGTTACATGGATTAGTCTTACCATCTACATCA
TCCCCGTAGCCATTCTAAGTGTCTGTTACGGACTGATAAG
TTATAAAATATGGCAAAACTTTAGGCTGAAGACCCGGCGA
GACCAGTGTTTGTCCCTGACCCCAAGGCCAACCAAAGGCG
CCGCGCTCTCTCGCGTCAGCAGCGTCAAGTTGATCTCCAA
GGCCAAGATCAGGACGGTGAAAATGACGTTTGTGATCGTC
ATGGCTTACATCATCTGCTGGACGCCCTTCTTCTTCGTTC
AGATGTGGTCCGCTTGGGATCCCATGGCTCCAAGAGAAGC
TATGGCGTTCATCATCGCAATGCTTCTGGCCAGTCTCAAC
AGCTGCTGTAACCCCTGGATCTACATGTTTTTCGCTGGTC
ATCTGTTCCGGGATCTCATGCAGCGCTGCCTTACGGTTTC
ACACTGTGGCTGTAAGAGGCACTGGAGAAATAAAAACCAT
TCAGGGACGGGTGCCATGAGGAGCTCCAGCAGCCAGAAGA
GTGTGACACAGTCCTCCACTACATAAGCGGACGCTACTAT
AAGATAACATAAGCTAAGGAATTACAGACTTTTTACAGGT
GTGGTGCAGACCTCAATTACATTAGTCATGGATGATTTCT
TCGTTGGCCTAAAATATGTATCTTTATAAATATATTTGCC
TGTCTTAAATGAGCCATTAATTTATGTACGACCATTACTT
TTTCAAATGTCACATACGAAAAACTTGGGGGGGGTCATTC
CAAGCTGTTGTCCATTAACCTTTATGTGCTGTTGGGGATG
TTTTCATCCACT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
oxtrl-201 Contained in:
OTHER oxtrl-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054983 (1)
  • Ensembl_Trans:ENSDART00000064853 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:FJ556869 (1) 1149bp
    CITATIONS (2)