ZFIN ID: ZDB-TSCRIPT-131113-3587
Transcript Name: si:dkeyp-21h4.4-001
Previous Name: dkeyp-21h4.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053376 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053376|OTTDARG00000037409|ZDB-GENE-131120-122 si:dkeyp-21h4.4|no_translation DKEYP-21H4.4-001 LG_ BX120006.15 Danio rerio antisense NOVEL, 588 bp
AGGAGGCAAGAATCATAAAAAACTGCAGCCGACTAGCAAG
GACTTGCAGGAACCGCACAGAACAAAGAGATCTTCACAAA
ACGAGAGAAGAAGGTGGTCTTTGGAGGAGATCAAGGCCGT
GGAGAAGACAATGATGGAATTCATAATGTCTGGAAAGGTT
CCTGGTAAAGCCCAGTGCATGAACTGTATCGAAAGTTCCC
CAGCAGCACTTCAAAATAGAAGTTGGGAGGGGGTGAAATT
TTATGTAAAAAATCGCATTGATTCCCTAAAGAAAAAATTG
TGAAAGGTAAGGACCTTCATCTAATTATTTTTTTCGTGTC
TGCCGGAAGAAAGAAAATTTATTACTTAAAAAAATGTGAA
AGGTAGGTGAAAGGGCCTTCACCACTGTTTTTTCTTCATG
ATTGTTGAAAGCAACAAGTTTGATTTCATTAAAGCAAAAA
AATGTAAAAGGGCCTTCACCAGTTTTGTCTTTGTTAAAGG
CAACATGTATGTGAATCTTGTTTAAGCAAACTCAACATGC
ATCTGCTTAAAGAGCAGTATACTAAAACGTTCATGTTAAC
ATTTAAATAAATGTTTAAAACACTAAAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-21h4.4-001 Contained in:
[BAC] DKEYP-21H4 (1)
OTHER si:dkeyp-21h4.4-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053376 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD052895 (1) 827bp
    CITATIONS (1)