ZFIN ID: ZDB-TSCRIPT-131113-3484
Transcript Name: tbc1d30-201
Previous Names: ch73-238h12.2-001, tbc1d30-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051277 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051277|OTTDARG00000035984|ZDB-GENE-030131-2064 tbc1d30|OTTDARP00000040311 CH73-238H12.2-001 LG_ FP102892.7 Danio rerio protein_coding NOVEL, 3422 bp
AACCGCAGCCTGTTTGAGTCCCTGCCAACCCGCGGCTCAA
GAAATGGAACAGACCCGGAACTCCAGTTCCTTATTGATCC
ACCTAAAACAATCTTTGCGGAGTCCCAATGCGTTCACCAC
AAAGTAATGCTGAACTTTAAAGAGAAATAAACCATGTCAG
CCGCGGTGGAAGTGGCGAAAGAGGAGCTGAAGGAGGTGAA
CATATGTGACATCTGCCCGGAGGAGGAGAGCGGAGTTTTC
CTCAGCGCAGGTGCGTCCTACCTGGACGGCTTTTCGGGGT
TTCATAAGTGGGTCTCAAAGATTGAGGTGTCGGATGGAGA
CTGTGAGAAAACGTCATCCAGGAAGGCTCACGAGGAGGAG
AAAGGAGGTCTGTATTTTGATCGAGAGGAGCTGAAAGACT
CCCGGGCTTCATCTTTGGTGGATTGTTTGCTGGTGGAGCT
TTATGACACGTACAGTCACGGTGTCCCAGGCTTGGACAGC
TCCACTGAGGCCTCCAGCTCGGACGCTTTTCTGGGCAGGA
GCAACAGCGGCTCTAGCTTTCTGCAGGAGCTCCAGGAGAA
GCACACCAGGCGCCATCAGGTCAAATATCTGGCTCAGAAA
GGTCCAGAAGAGCTGAAGTGGATTGTCCAGGAGGTGAAAT
ACCGCATCGCTGTACAGTCGGCTAAACTAGTGCGGCAGGC
CAAAAGGAAAGATCGACTCCGGCAGAAGTTCCAGAAGAAC
TGCGATATCGTGACCGCCTGCCTGCAAGCCGTCTCGCAGA
AAAGACGAGTGGACACCAGGTTGAAGTTCACTATCGAACC
CTCTCTAGGCAAGAACGGCTTTCAGCAATGGTACGACGCT
CTGAAAGCAGTGGCCAGACTGCCGGTCGGCATTCCCAAAG
AGTGGAGGAAAAGAGTCTGGCTGACCCTGGCTGACCAGTA
TCTTCACAGCATCTCTATAGACTGGGAGAAAACCATGAGA
TTTGCCTTCAATGACCGCAGCAATCCAGACGATGACTCTT
TGGGAATACAAATAGTAAAGGATCTGCACCGGACAGGCTG
CAGCTCTTACTGTGGGCAGGAGGCGGAGCAGGACCGGGTG
GTGCTGAAGCGGGTGCTGCTGGCTTATGCCCGCTGGAACA
AGACTGTAGGATACTGTCAGGGATTTAATGTGCTGGCGGC
ACTTATCCTGGAGGTCACTGAGGGCAATGAAGGAGACGCT
TTAAAGGTGATGATCTATTTGATCGACAAGGTGCTTCCGG
ACAGTTATTTCGCCAATAATCTGCGAGCACTCTCTGTGGA
CATGGCCGTGTTCAGAGACCTGCTGCGGCTGAAGCTTCCA
GAACTTTCTCAGCACCTTCACCACCTCCAAAAAGTGGCCA
ATCGCGAAGCTGGAGGCAGCTACGAGCCTCCACTCACCAA
CGTTTTCACCATGCAGTGGTTTCTGACCATGTTTGCCACG
TGTTTGCCTCATCACACCGTGCTGAAGATCTGGGATTCGG
TGTTTTTTGAGGGATCAGAAATGCTGCTGCGTGTCGCTCT
GGCCATTTGGGCCAAACTGGGAGAGCGTATTGAGGAGTGT
CAGACAGCAGATGAATTTTACAGTATTATGGGCTGCCTGA
CGCAAGAAATGCTGGAACACAAGCTCATCGACTCCAATGA
ACTCATGCAGACGGTTTACTCCATGGCTCCGTTCCCATTC
CCACAGCTGGCTGAGCTCAGGGAGAAATACACCTATAACA
TCACACCGTTCCCTGCGCCGGTCAGAGCCAACAGCAGTCT
GGCCCTCCATGGTTGGGAGAGTGATGATGATGCTGACATG
GATGATGAAGACTCTATCGTCACCGCTCTGGGCTGTCTGG
GACCACTAGGTGGCCTCCTGGCCCCTGAGATCCAAAGATA
CCAAAGGCACCTCAAAGATCAGAGAGCGGAGCAGAGCTGT
AATGGCAGTAATATGGCAGAGCTCAGTCCCGGGGCGGTTG
GCGCAGGACGAGCCGAACACCAGGCTGCCATCAACAGCAT
GATGCTGGAGCGCATGAGCACTGACATCAGCGCCCTGAAG
AAACAGTACTCGCGTATTAAACAGAAACAACAGCAGCAGG
CCGGACTGCTCTACATTCACACAGATAAGTGTCCAGCCAC
CAGTGTTCTTGCCTCCCAAATTGGTCCATCCCCAGTGGTC
AATCACCTTCTCCTGGGCAGGAGACCAAGACCCTGTGAAC
GATCCTTAAAGAATGGTATGATCCATAACGGTGGATCTCC
TCAATCCCACTCAACGCCGCTTCTGGATCAGATGGTTCGG
TCCAGACATCATTCGCCCTGGCGCACGCATGTTCGAGCAC
ACCGGAGGAACATCGCAAGAGCGAGGGCTCAGCTCGGCTT
TGATGACTCTCTGGAGGCAGAAGACGATCAGACGGATGAA
AGCAAAACTGAAGGAGCATCTATGGAGGGAGAGGAGACCA
AATCCGAGGAAGCAGACGAAGATAAAATTGAAAACACGGC
AGCTGGAGGCTCAGATGTTTCTAAGCAAGAACTGCAGGAG
ATTGATAGACAGCTGTCTGCACTAGAACTGGACCCGGAAT
CTTCACCAGATCCGTCAACTCCAGAACCAGCTTTGGATCC
AGACCCACAATCAGATCCAACTATTACTCCAGAACCACAG
GCAGATCCCAATCCCACTACTCCAGATCCTGATCCCACCA
TTCAAGATCCCAGTTTCACCATTCAAAATCCCAATTCCAC
CATTCAAAATCCCAGTCCCACCATTCAAGAATCCAAACCC
ACCACTAAAGATTCCTGTTTCACCATTCAAAATCCCAATT
CAATTGTTCAAAGTCCCAGTTCTGCTGTTCAAAATCCCAG
TCTCGCCATTCAAAATCCAAATACCATTGTTCAAAATCCC
AACTCCTCCATTCAAAATCCCAATCCCACCATTCAAGATC
CCAATCCCACAGATCAAAATCCCAATTCCAGCATTCAAAA
CCTCAATATCACCATTCAAGATGTCAATCCCACCACTCCA
CCTCAGGCTCCGCTCACATCCAGCCGCCGTCCCGGTTCCG
ACTCCTCCAGCTCCGAAAGTGGAAGCTCCCTGAGAAGAAG
TGCTTCATCATTAGCAGGAGATCCTCCAAAAGCACAGCAG
CAGATCTACTCCCCATTCCCTTGCATCAAAACACCCCGAA
AATCCACGGCTGCAAGAAACCTGGGTCTCTACGGCCCAAC
AGCCAGAACTCCAAACGTACACTTCCCACAGATGAGCAGA
AGCATGAACCGTGTAGGAAACACCACAAAACGCCGGTGAT
GAGTTGTAGACTGCTAATAATAAAGAAGAGCACTTATTGG
GTTCCTCTTCATTTGGGTTTAAATTCCAGACTTGTGAAAG
CACATGCATTTTGAAGTCTAATATGCTTCCAGATACTTAA
GCACTGCAAAAAAAAAAAAAAA

tbc1d30 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tbc1d30-002 (1) 701
mRNA tbc1d30-201 3422
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tbc1d30-201 Contained in:
OTHER tbc1d30-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000051277 (1)
  • Ensembl_Trans:ENSDART00000130588 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT605932 (1) 859bp
    GenBank:CT605933 (1) 671bp
    GenBank:EB927539 (1) 616bp
    GenBank:EB932689 (1) 497bp
    GenBank:AI585219 (1) 478bp
    CITATIONS (2)