ZFIN ID: ZDB-TSCRIPT-131113-3411
Transcript Name: jmjd6-201
Previous Name: jmjd6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050033 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050033|OTTDARG00000035195|ZDB-GENE-040426-17 jmjd6|OTTDARP00000039271 jmjd6-001 LG_ CU463857.9 Danio rerio protein_coding KNOWN, 1523 bp
ACACAGTTAGATTGCGCCATAAGGCGTGAAATAAGCTTGC
TGCCGCCAGGTTATCTAACTTTAGTTTATTATCAAGCCTT
CAGTATAGCAACCACCTCCGTCTTCTGAAATAAATACAAC
TTAATTCCGGTACCGCGTACAGTCTAGTCTGCGGCTAAAG
AGCCGCACACACATCTACAAAGGCCTCCAGTGACTGACTA
GCGTCTCCAGACTCCATAGACTTTCACTACAGCACAGTTA
GCAATAGCACGCGAAGCTAAAAGGCGTCGCGCAAAAGACA
AAACGCGTCGAAACGGCGAAGAATGAACCATAAAAGCAAG
AAACGGATCAAAGAAGCGAAACGGAGCGCCCGACCCGAGC
TGAAGGACTCAAGCGACTGGACCAAACACGAATACTGCAA
GAGCTTCGACCTGTCGCACAGGAGCGTGAAGGATAATGTG
GAGCGAGCGGACGTTCAGCGGCTCAGTCCAGAGGAGTTCA
TCCAGCGCTTTGAGAAGCCTTATAAACCCGTGGTTTTGCT
CAACGTCGAGGACTCGTGGCCCGCTCGTGAAAAGTGGACC
CTGGAGAGACTCAAGCGCAAATACCGCAACCAGAAGTTCA
AGTGCGGCGAGGACAACGACGGTTACTCGGTCAAGATGAA
AATGAAGTATTACGTTGAGTATTTGGAGTCGACTCACGAC
GACAGTCCGCTCTACATCTTCGACAGCAGTTTCGGGGAGC
ACGCCAAACGCCGAAAACTACTGGAGGACTATCAGGTGCC
GCTTTTCTTCAGAGACGACCTCTTTCAGTTCGCCGGAGAG
AAGAGACGCCCGCCGTACAGGTGGTTTGTAATGGGTCCGG
CCCGCTCTGGGACAGGCATCCACATCGACCCACTGGGCAC
GAGTGCATGGAATGCTCTGGTTCAGGGCCACAAGCGCTGG
TGTCTCTTCCCCACACACACACCCCGTGAGCTCATCAAGG
TGACACGGGACGAGGGAGGAAACCAGCAGGACGAGGCCAT
CACCTGGTTCAACGTCATCTACCCGCGCACACAGCAGAGC
ACCTGGCCCGACGAGTTCAGGCCGCTGGAGATCCTGCAGC
GCCCTGGAGAGACCGTGTTCGTGCCCGGTGGATGGTGGCA
TGTCGTCCTCAACTTGGACACAACCATTGCCGTGACCCAG
AATTTTGCAAGCACCACCAATTTTCCCATTGTGTGGCATA
AGACGGTGCGAGGCCGACCCAAACTCTCCAGAAAGTGGTA
CCGGATCCTGAAGCAGGAACGGCCTGATATTGCTGCTATA
GCGGATAAAGTGGATCTGCAGGAGTCGACAGGCATCGCCT
CGGATAGCTCCAGCGACTCGTCCTCATCCTCCTCCTCCAG
CTCCTCTGACAGCGACTCCGAGGCTGACTCGGGCTCTGAG
GGCGACGCCATGACCCACCGCAGAAAGAAGAGGAGAACAG
GAGGCATGATGGGGAACGGTGACATCACAAGCCAGGACGA
CTGCGCCAGCAAAGAGCGCAGTTCATCCCGGTGACAAAAC
TGA

jmjd6 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA jmjd6-002 (1) 3116
mRNA jmjd6-201 1523
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jmjd6-201 Contained in:
OTHER jmjd6-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050033 (1)
  • Ensembl_Trans:ENSDART00000157822 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF401484 (1) 1221bp
    GenBank:EE317427 (1) 884bp
    GenBank:CK360987 (1) 806bp
    GenBank:AF401485 (1) 681bp
    CITATIONS (2)