header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-3320
Transcript Name: smg9-202
Previous Names: smg9-001, dkey-79d12.3-001, si:dkey-79d12.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048581 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048581|OTTDARG00000034347|ZDB-GENE-030131-9385 smg9|OTTDARP00000038108 DKEY-79D12.3-001 LG_ BX005256.11 Danio rerio protein_coding PUTATIVE, 2342 bp
ACGTTTGTACCGTTTCACCCATACAACAGTCCTGTACCTG
TAGACGCAGACGTTTACCATTAAAATAACACAGTGCACAA
CGATCGAGGATAAAACAGCTGTTTCTTTTATATTCCCATC
ATCATAGCCGATCGTATTATTTATATTGATATTGCTTAAT
CATTTATTTATGAGTCTAACGTTATGGCTGTCGACATTCG
TCATTAATATGTCTTAAAACGAACTGCTGTCTTACTAAAA
ACCACAACACGTTCGAGTGGTAAATCTTCGTATTATAAAT
TAAGAAACTGCTCTCGAAGTTTTATAAGAACAGTCGTAAC
AGAAGTCGAGATCTCGGCAGTGTTATCCGGGTGTCAGCAT
GTCGGAGTCCGGTCACAGTCAGCCCGGTCTGTACGGTCAG
GGACGGCGGAGGAGGAGACGCCGAGAGCGAGATCCAGCAG
GACCCCCTGGTCAAAACCTCTCTGGCCCCAGTAGAGATCG
AGACTATGTTCCCCGCGAACGCAGGGATGGAAGTGAAGAA
TCCACTGGACCTCTTCTTCAAAAGACCCCTATCATTCTTG
CTAAACCTCCTGGAGAGAGAGTAATCCAAAGCAAGTGCTC
CAGCCAGTGGTCCTCCATCTTTGGAAAAGCCGATCATGCT
CATTAAAACTAGAGACGAAGGGGGGAAACCTGGGAACCCT
CCTGACATTCCTCCTTCAGCCTCAGGAGCAGGAACTGCAA
AAATGGAGAGGGAAGGACAGCGTCCAACCCAACCTGTGTA
TCAGATCCAGAACAGAGGCATGGGCTCAGCTGCGTCCGGT
GGAGCTGTGGATCCTGTGATTGGCCAGACTAAACTCCTCC
CCCCTGAGAAGATGAAGCACAGCATCAAACTTGTGGATGA
TCAAATGAACTGGTGTGACAGTGCTATGGAGTACCTGCGA
GACCAGACGGATATGCTAGTAGTTGGAGTTATTGGACTAC
AAGGCACAGGCAAATCCACAATCATGTCTCTCCTGTCTGC
AAACAGCCCTGAGGAGGATCAGAGGGCGTATGTATTCAGA
GCTCAGACGCAAGAGATCAAGGAGCGAGCCGGAAACCAGA
GCAGTGGGATTGATTTCTACATCACACAGGAGAGGGTCAT
CTTTCTGGACACGCAGCCAGTTTTGAGCCCTTCTATTTTG
GATCATCTCATCAATAATGATCGCAAGCTTCCACCAGAGT
ACAACCTGCCACATACATACGTGGAGATGCAGTCTCTGCA
GATCACTGCCTTCCTCTTCACGGTATGTCATGTGGTGATT
GTGATTCAGGACTGGTTCACTGACATCAACTTGTATAGGT
TTCTGCAGACAGCTGAGATGCTGAAACCCTCCACTCCTTC
GGCCAGTCATGACAGCACCGGCTCCTCAGGGCCAGATGAC
GGATCAGAGTATTATCCTCACATAGTTTTCTTGCAAAATA
AAGCAAGGAGGGAAGAGTTCTGTCCACGAAACCTGAAGAA
GATGCACATGGCAGTTGACAAACTCATGGCTCATTCACAC
CTAAAATATAAAGGCACATTGTCCATGCTGGATTGTAACA
TATTTCCGGGACTGAGCCGAGACTACATGGAAACAGAAGT
CAATCTTTTTCTCTTACCTTTGATGGAGAATGATGGGGAG
GATGCTTTGACAAGAGCAGGTTCAGGTCCTCCGCTCTTCT
CTCTTCTGCCTGGCTACAGAGGTCATCCCAACTTTTCATC
TCTAGTTTCTAAATTTCGCAGTCAGATTCTGGCGATGTCC
CGCAGTCAGCTCTCACACACAATCCTCACAGAGAAAAACT
GGTTTCATTATGCAGCTAGAATCTGGGATGGTGTTAAGAA
GTCGTCTGCACTGTCTGAGTATAGCAGGCTGCTCTCATAG
TCATGATGGGGCTACATAAACCTGTGAATTCATTAAGGAG
AGCTGAGCCCCTGATTTCAGACAGGAGGAAGTTCTCCAGG
AAAAGACTGGGCTACAGGAACGCAGGAGCACTGAATAAAC
TTCTGTGATGTCTGGATCACATTAGCAGAGTGCTGTGCAG
TTTGGGACGAGTTGTCTGTATGAAATGATCAGGTGTTTGC
CGATGTCCATTCAGTCATGTGTGACCACTGTTATTGCAAG
ATAAGATGGGCACAGATTCAGTCATATAAACGCTTTTGTT
GATACTGTAAAAATCTGAAGTAACCTGTGATTTTTCTATT
GTGGTCATCTGCTGGAAATAGCATCATTCAGCACATTTTG
CTTTACAGATGTCTGTTTGTGCATAAACTTGTAACTTAGA
TACAGTTACAGCATGGTTTCTTGTGATTGTTTCATGAGAT
TAAAAAATGTGCACTTTGTTCC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
smg9-202 Contained in:
OTHER smg9-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048581 (1)
  • Ensembl_Trans:ENSDART00000155754 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH442182 (1) 977bp
    GenBank:EE691925 (1) 911bp
    GenBank:EH468069 (1) 799bp
    CITATIONS (2)