ZFIN ID: ZDB-TSCRIPT-131113-3316
Transcript Name: si:dkey-56f14.4-203
Previous Names: dkey-56f14.4-001, si:dkey-56f14.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048547 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048547|OTTDARG00000034332|ZDB-GENE-131121-272 si:dkey-56f14.4|OTTDARP00000038077 DKEY-56F14.4-001 LG_ CR848666.4 Danio rerio protein_coding NOVEL, 1689 bp
ACTAGGGGGAAATGTTTGGCTCGGTATCCCTGCACTGGTT
TGCATCTTCATTCTCTGGATCTTCCCTTCATGTGTAAGGA
AAGCACTGACACATCTGCACCGCTTGGAGGCGTAACATTT
AACGTGCTAAGCGCAGCATCGACGCAGTGCTTCACTAGCG
CGCCTGTTCATTAAGGTGCTCAATTACAGCAAACAAGAAA
GCCCTGCCTGGAAACAGCACTGCAGTCATGGAAGCCTCAA
CAGGGTCATACACGCATCTTGACCAGAGTGCCTTTCATTA
TGATTATGAGACGTTGCGGACCACGGGGGTCATCCTAGCT
GTGGTTATGTTTGTAAGTGGGATCCTCATCGCACTGAGTA
AAAAGTGCAAATGCTCAAAATCCAAATCTAGTCCAGTGGA
AGGCCCTCCGAAGACAGAAGTTCCCCCTCAAACAGTGTAA
AGCAGATGGCGTATCAGAGCGGCCCATTTCAGCGAGAGGA
AATGCTCAGACGCACAAGGTTACTTACAGGAATGAGAGGG
AAAGCAGAACATGCTTGACCTCTTTTTGTAACTTCAGCCT
AAATGCTGATCTACTGCTGTATTTTTAGCTCTTACAGTTG
TGCTAAATCATGTCCCTTTTGTCCCACAATTCACCACACA
CCTCAGCTGATCACAGTTGCTTTACTTATGCATGAACAGT
TCAGTTTAATTACTACTATATGAGGCCTAGTTTAAAAAAA
TGTCTGAAATATTTATGGCAACCAAGATGAATGATTGAAA
TTTAACATCAGACTGTTTAAAGTTTACACAAGTAATATAA
AATTGAAATTTATACTCGTTTACATTTTATTAAAAAGCTA
ATTCGCAGCACTTGAGCATGAAATGTCGCACAGTTGCGTG
TCGAACCTGTGTAACTTGTGCATGCCAGGTTTCAACACTC
TGTAAGACAACCGTGTAACGTTCTAATAATTTAAAATGCA
TTATGAAGTAAATTTATAAGTTGAATTTTTAATTTTTCTG
TAACTTATTACCAGTAAAAACTTTAAAAACAACCTGTAAA
GTACAGATATTTCCTGTTTACACATTTATTAGATCAGTAA
AAACATAATTATTATGCAGCTTCACATAACATTTGAGGGC
TAAGGTAGAAAAAATAAGTCTTGCCTTAAAAACTCATGGT
GCAACTGAATCGAATACAGAATTACCAACAAACTACTAAC
GGAACTACATCACAATCTAAAAAACCTTATGAGAGTCTAG
AGAAATCGATCGCATGAATATTTGAATGTATTCCAGAGAT
GAAAGCACTTTAGAAAGTAATGTTTAGTTACTGAATATGA
AACAATTGAACTGCAACTGAATGTATGCATTTATGTATGT
ATGTGTCTCATATTAATGAATGAAAAAGCATCTGTGTACA
TTTGAAAGAATGAATCACTGCTCTTTTCAGTCAGCATGTT
TGTGAAGGAATGCTTAATAACTCTTTCAGTCAGTCGTGGT
GTGCGTGCGTGCGTGCGTGTTTGTCTTGAAGTGAAGTAAA
TGAGTACAACTAAACATTCACATCAGTCATAATGAAGAAC
ACATCATATATACAGCTACTGTATGTAAATGAATACAACT
ACTGTATGTCAATGTATTTTATTAGTCACGCAAACATTAG
TCATGTACCAAAGGCATTCAGCTAAATAAAACATACTGAG
TTACAGAGA

si:dkey-56f14.4 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-56f14.4-003 (1) 439
mRNA si:dkey-56f14.4-201 (1) 1009
si:dkey-56f14.4-203 1689
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-56f14.4-203 Contained in:
OTHER si:dkey-56f14.4-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048547 (1)
  • Ensembl_Trans:ENSDART00000156407 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC129467 (1) 1597bp
    GenBank:BC122121 (1) 1537bp
    GenBank:BC142855 (1) 1517bp
    CITATIONS (2)