ZFIN ID: ZDB-TSCRIPT-131113-3261
Transcript Name: hspbp1-201
Previous Names: hspbp1-001, ch73-108n20.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047262 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047262|OTTDARG00000033593|ZDB-GENE-030219-55 hspbp1|OTTDARP00000037147 CH73-108N20.1-001 LG_ CU929085.7 Danio rerio protein_coding KNOWN, 1877 bp
ATATCACATCGACGGCATGTGCACGCGCGCCGCTGTCTAG
CAGCAGGTAGAATCTGGAAGCTTCTGGATCCGCAGTGGTG
TGTTTATAATAACGGAGCTGAACTGAACTCAAGTGTAACA
TTATTTACACTGCGGGGAAACTTGACACACGTCCAAGTAA
CGTCTGCTACTACTGCTAAATCGGACACACAGCATTTAAA
AAGATGGCTGAAGGCAGAGGTAACCGGCATCACCCTCGTA
ATCTGCAAGGTGTTCTTCAGATGGCAGTGGAGGCCGGTTC
TGCTTCTGACGGTCCATCTCCGCTAGAACCCATGACACAA
GAGAGGATGGATTTTCTGCGAGGAGCTCTTTCTGAAGTGT
GTAAAGGACAAATGGATGAGGTCGAGCAGATGAAGCGGTG
TTTGGAGGTGCTGAAAACTGATGGATGCAAGGACAGAGAA
GTCGAAGGAGAGGAGGAGGAGGAGCAGGAGGACGACGAGC
GGGAAGAAGCGCTGGAAATGCTTTCTGAGCTTTGCGAAAA
CCTGGACAATGCAAGAGATCTGATGAAGCTGGGTGGTCTG
GATCTGTGTTTGTCACGGTGTCTCTGTCACACAGAGGCAG
GCATTCGCTGGAGAGCAGCTCAGCTTATCGCCAGCTCGGC
CCAGAATATGCCGGAGGTGCAGTTCTACCTGCTTAACCAG
GGGGCGCTGCTAACCCTCCTGCAGCTCGCAGATAATGACC
CACACAGCACAGTCAGGGTTAAAGCACTCTACGCCGTGTC
CTGTTTAGTGCGTGAACAGGAAGCTGGACTGAAGGACTTC
CTTTCACATGACGGCTTTTCAGTGCTGATGAGGGGGATGC
AGTCAGACAGTGAGAAGCTGAGAACTAAATCAGCGTTTCT
TCTTCTAAACCTTTTGAACAGTCATCCAGAACACAAAGAT
ACAGTGTTGTCTATGGGAATGGTCCAGCAGCTGGTGTCTG
TTCTCCGCTCTCCTCATTCCTCTGTTCACGAACATGTGCT
TGGCGCCCTCTGCTGTCTAGTGGAGGACTCTCCCCGTGGC
ATGAGCGACTGCAGAGATCCATCGCTGGGCTTGGAGGAAC
TGCTCAAACAGAGAGTGCAGGATCTAAGGGGCCAAGAGGA
GAGCCTGGAGGAACTGGAGTTTTGTGAACGTTTGCGAGCG
GTTTGTTTTCCGGGACAAACGCAAGAGGATAATGCCATGG
ATCGCTGACCATCTGATTGCTGATTCAACGAATAACAGCA
ACACCCAGTTTGTATTCCTTCTCTGTTTAAGAGAGAAACC
AAAACAATAGGAATAATACTGTTAAAAAGATCAACGTGAA
AGAGACTTTTAACTCTGAGTTTTCAGAGATGAGTTTAGCT
GTGTGTGTGTGTGTGTGTGCGTGCGTGCGTGTTCATGTAC
TGGACACAAACACTCGTGTGTAATGATGATGAACATGTAC
ATTTATTTATAATATCTTTGTTCGTTATTATAAATGTTCT
GTTATATGGTCAACTTTCGAAACATTCTTAAAGGGACAGT
ACTCTCAAAAATGACAGTCCTGTCATTTGTTCTCACTTAA
CTCTTGAGTTTCCTCTGTTGAACATAAAAAAAGATATTTT
AATTCATCCGGTGACTTCCATTGTAATTTGTTGTCCTACT
ATGTAAGTCAGTGGGTACCAGCATTCTTCAAACTATCTTA
TTTTGCATTCAAGAAAGAAGAAAGAAGTTCATCAAGATTT
AAAACCACATAATAGAAAGTAAATAATGAGATATTTGACA
TTTTTGGGTGAACTATCTCTTGGTCAATCACACAAATACA
AAGCCATAATGTAGAACTGCACATTATTATTATAGACAAT
AATTTAAAATAAACACATTCAGACCTGTGTTTAAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hspbp1-201 Contained in:
OTHER hspbp1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047262 (1)
  • Ensembl_Trans:ENSDART00000162124 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY024336 (1) 1896bp
    GenBank:BC044352 (1) 1881bp
    GenBank:BC049402 (1) 1661bp
    GenBank:BC164133 (1) 1069bp
    CITATIONS (2)