ZFIN ID: ZDB-TSCRIPT-131113-3260
Transcript Name: mespbb-201
Previous Names: dkey-52p2.2-001, mespbb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046875 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046875|OTTDARG00000033343|ZDB-GENE-110609-1 mespbb|OTTDARP00000036906 DKEY-52P2.2-001 LG_ CR854891.10 Danio rerio protein_coding PUTATIVE, 860 bp
GCCAGGCCTAGCGGTGGTCTGGACAGGCCTGTAGAGGTGT
CACTTCACACCTCTGAGAGCTCAAACTGGTATAAAGCCTC
CCTCTAGCAAAACCCAACAACCACAACCTATCTCCAACCA
CACAGAATGGACGCATCATCTCCTTTCTTCAACTACATCC
AGCAAAACTCCTGGAGCTCAGACTCCGAACTCTACAACAT
CTCATCTCCAGAAACCGTTTCTCCTTCCTCCTACATGGAC
TTCTCTCCATCAGCGCAGGCTCAGAGCGTTTCTCCAAAAC
CAGAGATTTCGGGTTCCTCGTTTCAAGATGGTGGACGGTC
CCGTGTTGGAGTTAGAAGAACGAGATGCAAGAATCCTAGT
AAACAAAGACAAAGCGCCAGTGAGAAGGAGAAGCTGAGAA
TGAGGGATCTGACCAAAGCTCTGCATCACCTCAGGACGTA
CCTACCACCTTCTGTAGCTCCCGTTGGCCAAACGTTGACC
AAAATCGAGACTCTTCGCCTTACCATCCGATATATTTCCT
ATTTGTCTGCTCAACTAGGCCTCAGCGAAGAGTCTTTGTG
CAAGATGAGAGACTTAAGGGTTTCCGGATATCAAGAGATG
CCTCAAAACCACTGCTATTCCACTGCTGAGTTTTGGGGGT
CATGTCAAAACAGCTGCGGAACTTCAGAATCTGTGTTGAG
GAGGACGGATATGGATTGTCGGCAGGTTTTTATGGGAATG
GAAAAACCGGCTTATGACGATTCCTTTAATTCCAGCTCAG
AATCTCTTCTAGAGAGTCCGTTGTATGCTGATTCAGCATT
GACATATCAGGGCTACAACAAAGGCGTCCACTGTTCGATC
GCACCAGAGTTCTGGGGATG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mespbb-201 Contained in:
[BAC] DKEY-52P2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000046875 (1),  Ensembl_Trans:ENSDART00000156846 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT636995 (1) 746 nt
GenBank:CT713375 (1) 680 nt
CITATIONS (2)