header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-3078
Transcript Name: dhrs9-201
Previous Name: dhrs9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059655 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059655|OTTDARG00000041366|ZDB-GENE-030131-1249 dhrs9|OTTDARP00000046421 dhrs9-001 LG_none CU467880.7,CR626882.8 Danio rerio protein_coding KNOWN, 1351 bp
CCTTCGCACTCTGACTGTCACTTCTAAATCTTAGACGCCA
ATCTTGTGTGATTTTGGGCTCCTGAACAGTAAACTGCTGT
GCGTGTGTGTGATCTCTCAGCGCCCCCTGCAGGAACAAGA
CGACACAGGCATTACATAACAATGAGTAAAGCGGTGTCAG
ATGCTCAGCCGCAGAAAAAATAAAAAGATGCTCAACGGCA
CAGAAGAAACAACAAACACATTCCCAAAGCACTGAGGACA
GCGACTCCAGCCTAAAACACATCTCCACTCTGAAAGCTGA
CAATATATAAGCGACATGTACCTGTACATTGCCGGCCTCG
TAGTCTTGTTCTACGTCTATCGGTGGTTCAGAGAACTGGG
CAGAGTCTCCAATAAATCAGAGAAGTTTGTGTACATCACA
GGCTGCGACACCGGTTTCGGGAATCTCTTGGCCAGACATC
TGGACACGAAGGGTTTTAGAGTCATCGCTGGCTGCTACTC
AGAGAAAGGAGAGGACGAGCTGAAGAAGATCTGCTCTGAC
AGACTCACGACGCTGCATCTGGATGTGACTGACAATGAGA
ATGTTAAAAAAGCTGCAGAGACTATTAAAAGCCTGGTGGG
ACAGAAGGGTCTGTGGGCCGTGGTGAACAACGCCGGGATC
GCCTTCCCCACGGCACCCAATGACTGGCTGGAGATTGAGG
ATTTCACACCCATGATTAATGTCAATCTGATCGGGGTCAT
CGCCGTTACTCTGAGTGTTTTACCACTCATTAAGAAAGCC
AAGGGTCGAGTGGTGAACGTGGCCAGCGTTTTCGGCAGGA
TCAGTACTCTTGGAGGAGCTTACTGCATTACAAAGTATGG
AGTCGAGGCTTTTAATGATGCTCTCAGGAGGCAAATGGCA
CCGTTTGGAGTGAAGGTTTTGTGCATTGAGCCTGGATTCT
TCAAGACCATCGTCACTGACTTCAATATCGTGGAGAGTAC
TTTGCACAGATTATGGAATAAACTGCCTCAGGAGGTCAAG
GATGAGTACGGCAGCGACTACGTTGACAAGACAAAGCTGA
CGGCCAAGGAATTGTTGGAGAAGCTGGCGGACGGGGATCT
GATGAAGGTGGTGAGCTGTATGGAGCATGCAGTGGCTGCT
GTTCATCCTCGGACACGATATTCTCCGGGCTGGGATGCCA
AGTTCTTCTGGCTGCCTCTGTCCTACATGCCAACCTTCAT
CTCAGATGCTTTACTCCTGAAAAAGGCTGTTCAACCAAAA
GCTTCTATTCTGTGAGCCTAAGTGTTGTTTTAGGATGCAC
ACTTGAAGAAAAAGTCTTTATTGCACATTTGTACAATATT
GGGAATGAATAAAATACATTTTTAAAGGTGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dhrs9-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000059655 (1),  Ensembl_Trans:ENSDART00000022074 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC059614 (1) 1163 bp
CITATIONS (2)