ZFIN ID: ZDB-TSCRIPT-131113-304
Transcript Name: tbc1d30-002
Previous Name: ch73-238h12.2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051278 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051278|OTTDARG00000035984|ZDB-GENE-030131-2064 tbc1d30|no_translation CH73-238H12.2-002 LG_ FP102892.7 Danio rerio protein_coding NOVEL, 701 bp
CAGATCCTGCCTCACGACTCAAACACACGCAGAAATGCTG
CTAACTTCACTTTAGGTCTGTCTGTCATTTTAATAGCATG
AAACAGTAACACAGATGGACTCAGGAGTGGACACCAGGTT
GAAGTTCACTATCGAACCCTCTCTAGGCAAGAACGGCTTT
CAGCAATGGTACGACGCTCTGAAAGCAGTGGCCAGACTGC
CGGTCGGCATTCCCAAAGAGTGGAGGAAAAGAGTCTGGCT
GACCCTGGCTGACCAGTATCTTCACAGCATCTCTATAGAC
TGGGAGAAAACCATGAGATTTGCCTTCAATGACCGCAGCA
ATCCAGACGATGACTCTTTGGGAATACAAATAGTAAAGGA
TCTGCACCGGACAGGCTGCAGCTCTTACTGTGGGCAGGAG
GCGGAGCAGGACCGGGTGGTGCTGAAGCGGGTGCTGCTGG
CTTATGCCCGCTGGAACAAGACTGTAGGATACTGTCAGGG
ATTTAATGTGCTGGCGGCACTTATCCTGGAGGTCACTGAG
GGCAATGAAGGAGACGCTTTAAAGGTGATGATCTATTTGA
TCGACAAGGTGCTTCCGGACAGTTATTTCGCCAATAATCT
GCGAGCACTCTCTGTGGACATGGCCGTGTTCAGAGACCTG
CTGCGGCTGAAGCTTCCAGAACTTTCTCAGCACCTTCACC
ACCTCCAAAAAGTGGCCAATC

tbc1d30 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tbc1d30-002 701
mRNA tbc1d30-201 (1) 3422
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tbc1d30-002 Contained in:
OTHER tbc1d30-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000051278 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL921520 (1) 539bp
    CITATIONS (1)