header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-2517
Transcript Name: myo9ab-002
Previous Names: myo9al2-002, ch1073-360m4.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056309 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056309|OTTDARG00000039176|ZDB-GENE-080424-6 myo9ab|no_translation CH1073-360M4.1-002 LG_ CU633744.4 Danio rerio protein_coding NOVEL, 497 bp
ATCCTCCTCTTCCAGAAACCGGTACTAATCGCGGTTAGGT
TTATTGGCATTTCCAGAACGGTGACGTCGGGTAAGAGTCG
TGCTCGTAAATCTGGCCATCACACGCCGTCTCCACCTTTA
AGTCCTCGGGCGTCTGAGAGGGAGGAGCCTGTTGATGAGG
GGGCGGAGCCTGTGCTGAGCGAGCAGCAGCAGGCAGCAAT
GCAGCAGGAGGAGAAAGTGTTGACGCAGCAGATAGAAAAC
CTGCAGAAGGAGAAGGAAGAGCTGACCTATGAGATGCTGG
CTTTGGAGCCGCGAGCGTCTGATGATGAGATGCTGGAGTC
GGAGGCGTCAATCGGGACGGCGGACAGCTCAGAAAACCTG
ATGGAGTCGGAGGGAGCCGCTTCTGATCCGTGGGAAAAAA
GCCCCGGCGCAGTGTCTGCATCTCGCTGGAGGAAGTCGGA
GTCTAAAAGCAGGCGATGTTTGCGGCGTCAGCCTGAATCT
CTGGACTCTGTGGATTC

myo9ab TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA myo9ab-203 (1)    Ensembl 7584
ncRNA myo9ab-002 497
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myo9ab-002 Contained in:
[Fosmid] CH1073-360M4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000056309 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB948487 (1) 408 bp
GenBank:EB915619 (1) 286 bp
CITATIONS (1)