ZFIN ID: ZDB-TSCRIPT-131113-2500
Transcript Name: fem1b-201
Previous Name: fem1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056250 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056250|OTTDARG00000039185|ZDB-GENE-071009-3 fem1b|OTTDARP00000044114 fem1b-001 LG_ CU183952.17 Danio rerio protein_coding NOVEL, 3378 bp
ATTAAACAAATCACCCCTTCTACTTTTATCGTGCTTACTT
TTATTTCGAAATCAGCAGGATGTCGAATGTCGCACTTCCT
GTTTTTAATGACTTCATTTCCAGGCGTCGATACTGGCAGA
GGTGAAAGACACAAACACAGAGAGAGCTTCGGTCTGAGCT
GAAATTCGCGTTTACTTCACCGAAAATCTGCTTTTTCTCA
GTCAACACGATCGTCGGACACCACCGCGGAGGGATTCAGA
TTTAAAAACCCGAAACACAAAGTAAACAAAGCTCATCTTT
AACGTCACTCACAAGAAGTGAAACAGAATTCCGACTGAAA
CTCGCTTAATTCCGTCAGCATCTGCATATTTATTAAACCT
CACTACACACCGCGTAGCATTATTAATCAGGAATGTTTAT
ATTTTAAGATAATTATTTATAATATATGGTATAATAGCAG
CCGTTTGTATTAAAAGTTACACGATCGAGACTATAACAAA
AGCTCCATCTTAGTACCGTCAGATCTTAATAATACTTGTT
TTTAATTGATTGTAATGGCCGTGGGTCGTTCAGAAACTCT
ACACAAGCCTCGTCTATGAGCGGTGGAGCTCCGGCAGGTG
TTTTTAATGGGAGGCCGGTTGATCTGCTCTGAGATCAGTG
GGCGAATCTTGCACCGATGGCGGAGGTACCGGTACCGGCT
CTGGCCCGGTTGGAGTCCCTGGCCCGGTATGTGCACAAAG
CGGCCGGTGAAGGCAGAGTCCTGACCCTGGCCGCCCTGCT
CCTGAACCACTCCACCGTGCAGACTCGGTATCTTCTGGAG
TTCGTGACCCAGCTGGCTGGACAGAGATCCACACCGCTTA
TCATCGCCGCCCGGAACGGACACGACAAGGTGGTGCGGCT
GCTGCTGGATCACTATAAGGTGGACACGGAACAAACCGGG
ACTGTCAGATTTGACGGGTATATTATCGATGGTGCCACGG
CTCTTTGGTGTGCAGCTGGCGCTGGTCATTTCGAGGTGGT
GCGTTTGCTGGTTTCCCACAATGCCAATGTGAACCACACC
ACCCTCACCAACTCCACTCCGCTCAGAGCCGCGTGCTTCG
ACGGCCGGCTGGACATCGTGCGCTACCTAGTGGAGCACAA
GGCCGACATCAGCATCGCCAACAAATACGGAAACACTTGC
TTGATGATCGCCGCCTACAAAGGGCACACTGACGTTGTTT
ACTTCCTTCTGGAGCGAAGAGCTGATCCCAACTCCACAGC
TCACTGCGGAGCCACCGCGCTACATTTCGCCGCCGAAGCC
GGACATTTGGAGATTGTGAAGGAGTTAGTACGATGCCAAG
CGGCGATGGTGGTGAATGGACATGGCATGACGCCATTAAA
AGTGGCCGCCGAGAGTTGCAAGGCTGACGTTGTAGAGCTG
CTGTTATCCCATCCAGACTGTGACGTACAAAGTCGCATTG
AAGCATTGGAACTACTTGGAGCGTCTTTCGCTAATGATCG
AGAAAATTACGACATTCTTAAAACTTACCACTACTTGTAT
TTAGCAATGCTGGAACGGTTTCGGGATCCCGACAGAGCTA
TCTCTAAAGAGCTGCCGTCTCCTGTTGAAGCGTACGGTGG
ACGATCTGAATGTCGGAATTTACAACAACTGGAGGCCATT
CGACACGATCGGGACGCACTTCACATGGAAGGACTTATGA
TTCGCGAACGAATTCTGGGTGCGGATAATATTGATGTGTC
ACATCCCATAATATACAGAGGCGCAGTTTATGCTGACAAC
ATGGAGTTTGAGCAGTGCATCAAACTTTGGCTGCACGCCT
TGCAACTACGCCAACAAGGAAACCGCAACACGCATAAGGA
TCTCTTACGATTTGCGCAAGTGTTCTCGCAGATGGTTCAC
TTAAAAGAGCCGGTCATTGCGTCAGACGTTGAACATGTTT
TACGCGCCAGCGTACTAGAAATCCGACGTAGCATGGCGCG
TCTACAAACCACCACAGAAGTGGAATTACCGGCAGCCACC
GATAATTACGAATCCAACGTGTTCACATTTCTCTATTTAG
TTTGCATTTCTACGAAAACGCAATGTGGCGAAGAGCAGCG
AGAGCGCATAAACAAGCACATCTACGATTTAATACGCCTA
GATCCTCGCTCCAGAGAGGGATCATCACTTTTGCACCTAG
CGGCTAGCTCTAGTACACCTGTCGACGACTTCCATACTAA
CGATGTTTGCAGTTTTCCCAATGCGCAAGTGACTAAGCTG
CTCATAGACTGCGGCGCTCAAGTGAACGCAGTCGACCATG
AAGGAAACAGTCCACTACACCTCATAGTACAGTACAACCG
CCCCATCAGCGACTTTTTAACCCTCCACGCCATCATTATT
AGCCTCGTGGAGGCTGGCGCCCACACCGACATGACCAACA
AGCAGAAGAAGACGCCGCTGGATAAGAGCACAACAGGCGT
TTCTGAAATCCTCCTGAAAACGCAGATGAAGATGAGTCTG
AAGTGCTTGGCGGCGCGCGCCGTGCAGCAACATCAAATCC
TGTATCGAGACCAGATTCCCAAAAGCCTGGAGGAGTTCGT
TGAATTTCATTGAACCGTGTTTTCCGCTCAGATCTGGCTT
TTGGGGTTTGTTTTAACTTGGTGCTGAGGACTTTCATTTT
GACCTTGTTTACGTAAATAATGTTCCGACTGCTGCATTTT
TAGCGACTAGAGTTTCTAGTTTCATCCTCATAGTTTTTTT
TCGTTTTTAACAAATCTAAGAGGACGTCGATGCTGATGGA
CTCTTATTTCTTGTTTTGGCGAACAGCATTTTATTGTTTA
GTTCTGACGATTTGAGCAGCGTTTTTATTTTTAAACAAGC
TGCTCTTTTGTCAGTTTCTTCGTTTCTTAACATATTTTAT
AAAAGGTTTATTTAAAACAGAGTTTATTTTATGAGGAATC
AGTGGGCGAGTGTTGATGTCCTAAAGCTGAACTCCGTGCC
AGATTTCTTTTATTTGAATATTAAAATGTGCCTGTACCCA
GAGGTTGGACGTTTATAATTATTATTATTGGTGTTTTTAT
TAACATGACGCCACTGTAAAGCCAATTAGAGAGTCTGTGA
TTCAGACTCGATCATGTGCTGGAGCTCTATTGGAGTCACG
GGGCCTTACTGTTCTGGATGGTGCTGTTGTGTGTGTGTGT
GTGTGTGTGAGTGAGAGAGCAGCATGTCTTCCTGCTTTTG
GCTCCGTTTGTGTGTGTGTGTTTGAGTGCATGTCTGAGTA
CAATTGGCCAAATTTGAATGTGGAGTTTTTTAAACGATGT
ATATTTGCACCATTATTAATTCCTAAATTACTGGAGGTTA
CTGTGTGTGTTTTTATTTCTGAACCAAATCAAACAAGATT
AAAAACATTGATCCGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fem1b-201 Contained in:
OTHER fem1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000056250 (1)
  • Ensembl_Trans:ENSDART00000090803 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CV486753 (1) 777bp
    CITATIONS (2)