header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-2250
Transcript Name: tulp4b-202
Previous Names: tulp4b-001, ch211-195g8.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055224 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055224|OTTDARG00000038545|ZDB-GENE-130530-708 tulp4b|OTTDARP00000043319 CH211-195G8.3-001 LG_ CR407704.10 Danio rerio protein_coding PUTATIVE, 6896 bp
ACGTGATCAACAGCACCATTCCGTCAGAGCGCGGGTTGCC
TTCGATTGCCAAAAAATCCCTCCTTCAAGGATTATTTTGC
GCCACAATACAGCATCCCTCTTCGTGCCTTTAATGTTCAG
CGGGGGTGAAAATCCACTGCGAGAATCTGGCAACCATTTA
GACGCATTGAGAGCGAGTTGGTAGAGAAATGCTTGGACTG
CTGAAGGCTGGTTTTGTATGGTGACTGAGGGAAAGCTACA
GCGGGCCTTGACATTTGATTATTTTGTTGAATAAAAATAG
GATAGGCTGTATTGCTCGTGCTGTGCTGTGGTCACAGACA
ATAATGGCCTGATTTTAGACACGCTCTTTCTTAAGACACA
TCTGCAGTCAGACATTGCTCTCGTTTTACTGCACATTTTT
TGAATAAGCAAGCAAAATGGAGCACTCCTTCAAAGACCGG
ATTCGGACTAATAATGTCCAGGGACTATGAAGAGTCTGGT
CAGTCTGTAGGGATGTTGGCTGCGGTGGAGCATGGTCCGG
TCCTCTGCAGTGACTCCAACATCCTCTGCCTCTCATGGAA
AGGACGGGTTCCTAAAAGTGAGAAGGAGAAGCCGGTGTGC
AGGAGACGCTACTATGAGGAAGGCTGGCTGGCCACCGGGA
ACGCCAGAGGTGTTGTGGGAGTGACCTTCACGTCCAGTCA
CTGCAGGAGAGACAGAAACACCCCGCAGAGAATCAACTTC
AATTTACGGGGTCACAACAGTGAGGTCGTCCTTGTTAGGT
GGAATGAACCGTTTCAGAAGCTGGCAACGTGTGATATGGA
GGGAGGGATATTTGTGTGGATCCAGTATGAAGGAAGATGG
TCTGTAGAGCTGGTCAATGACAGAGGTGCTCAGGTGAGTG
ACTTCACCTGGTCCCATGATGGCACCCAGGCCTTAATCGC
CTACAGAGACGGTTTTGTGCTGGTGGGCTCAGTCAGCGGT
CAAAGACACTGGTCATCTGAGATCAATCTGGAGAGTCAAA
TCACCTGTGGAATCTGGACCCCCGATGACCAGCAGGTGCT
TTTTGGAACGGCAGACGGGCAAGTGATAGTGATGGACTGC
CACGGCCGTATGCTTGCCCATGTTCTGCTGCATGAGTCAG
ATGGCATTGTCAGCATGTCCTGGAACTGCCCGAACTTTCT
GGTGGAGGACAGCACCGAGAGCGACACTGACTCTGATGAC
CAGACGCCAGCTCACGTTCAAAATCTGAAACCACTGCTCA
CGGTCAGCTTCATATCAGGAGATATCAGTTTGATGAACAA
CTACGATGACCTTTCACCTAACATTATCCGCTCAGGACTG
AAAGATGTGGAGGTGCAGTGGTGCTCTCAGGGAGATCTGC
TGGCCGTGGCTGGGATGGAGAGACATGGGCTGCCCACTGA
CTCTTTAATGAGGAACGCCCTTGTCAAGTTTTACAATGTC
CAAGGAGAACATATATACACTTTAGAAACTCCAGCCCAAA
GGCCCATCACCACTATCTGCTGGGGTCACAGGGACTCGCG
GTTGTTTCTGGCCTGTGGACCAGCCCTGTATGTGGTGCGT
GTGGAGCACCGTGTGGCCAGCCTGCAGCTCCTGTGCCAGC
AGGGCATTGCCAGTGCTCTGAAAGAGGAGAGAGATGTTGG
AAAACTGAACATGCCTTCACTCCTCTGCTCCTACGTCACC
ACTGCATTCATTCCAACCATCAAGCCCCCCATTCCTGATC
CGAACAACATTAGAGACTTTGTGAGCTATCCCACAGCAGG
GAACGAACGATTGCACTGCACTATGAAGCGTTCAGAGGAA
AACCCTGAGGCTGGAGGCCCCTGTTATACCCTCTATCTGG
AACACCTCGGAGGTCTGGTGCCTATTCTCAAGGGCCGTCG
CATCAGCAAACTGCGACCTGAGTTTGTCATTATGGACCCA
AAAATGGATGGCAAAGCAGATGAGGTCTGTGTAAATGGCA
TGATCTCCTATATGACTGACAGCTGTAACTGCTCAGACTC
TAGTGATATTGAGCTGAGTGATGAGTGGGTTGGGCGAAAG
TCGCCCAAACTTTCCAGAGGAAACAGGTCTCCTAAGCTTC
CTAGGTACTCTAAACATATAAGAATTAATATGGAATCAAG
GAAGTCTCCAAAACTTGCCCAAACATCTCAAGAAATGTCT
AGGTCGCCTAGATTACCAAAGAAGCCTCCACTTCGGTCTC
CGAGTCTCACTCGAAGAGAATTTCCAGTTGATGGTTTTAG
TGAGCATAATTACTTGGCCCAGGTCACGTCTAACATCTGG
GGGACAAAGTTTAAAATAGTGGGTCTTGCCTCTTTTTTGC
CAGCTAACCTGGGAGCAGTTATTTATAAAACTAGTTTGCT
GCACCTGCAACCTCGTCAGATGACCATCTATTTGCCTGAA
GTGCGTAAAATTTCCCTGGACTTCATGAGCCTGCCAGTTT
TCAACCCCAATGTGTTCAGTGAGGATGAAGATGATTTACC
TGTTATGGGACCTTCTGGAGTGTCAGCCGACAATCCTTCT
TGCACAGTTAATATCCCCATTGCCCCAATTCACAGCCCTG
CTCAAGCCATGTCACCTACTCAGAGCATAGGCCTTGTGCA
GTCTCTACTAGCCAACCAGAACATACAGCTTGATGTCCTT
ACCAATCCTACTGCAACTGCAGCGGCGGCAACTGCAGCAG
CGGCAGCAGCAGCAGCGGCAGCAACAGCAGCAGCAGCAAC
AGCAGCGGCGGCTAATGCAACAGTATCTGAGCACAGTCAG
GATACTGTTACAGCACAGTACACTGTGCCAACCAGATACT
CCAACCCTGGACAGGTGATATTCAGTGGACTGGAAATGAA
TAACATTTTGAGTGGAACTCTTCCTCCCCCTCCACATCAT
CTGCCACAACCACCCCACCAACAACTTCCTTCACGACCAC
AGTCATTCATTGAAATGGACACTCTTGAGATCCAGTTGCG
CAAGGTAAACCCGCCTCCACCTTATCCCGGTACAGTGGTA
TCAGCTGCAGCTGCTATCCCTACTACAGCCCCTCCTGGTC
TTCTTGTTAGCAATGAGAATGGCACTACGCTGTCAACAGA
TACATGTTTAACTAAGGACGAATTCTCTCTTCACCCAATT
AGTCTACAATACCCAACTCCATTGGGTTATGAAAGAATCA
CCACATTTGACAGCAGTGGAAATGTCGAAGAGGTGTGTCG
TCCAAGAAGACGGCTGTTAAGAAACCAAAATGCTTATGGG
ATGCAGGGAATGGGCAGCTCTGCTACACTGAAAGTAACTT
CATCTGAAAACAAAAAGGTCCAGTTGCCATACAGCTCAGC
AACTCTTAGTCGCCTCTCAGTGCCTAGATATTCCATACCA
AGTGGAGATCCACCACCATATCCAGACACATCCAACCAGA
TGAACACAATCAGAAGTCCTACGCAAAGGATTGACAGCAG
TTTGATTCATGCCACTTTGCGTCGAGATAGAAGGGAACCG
TCTCTGAAGGTTTCTCAAATGGTGGATGCAGTGAGGACAC
TACCAACAAAATCCAAAATGAACGGCTCCCTCACGCTGTC
TTATCAGCCGAGAATACCCTCTGCTTTGTACACATGCACT
CAGTGTAGCAGTAACAGCAGCAGCACTAGTGTGAGTGTCA
CTGGTGGTGGCACTAACAGCAGTGGAATAGCTGGAGGAAC
GGTTGTGAGGCAAGACTTCCCACCGGGCAAAGGAGCGCAA
CACAGCACGATAATTGTGCACTCCAAAAGTGCCTCGCCAT
TAGCATCTCAGTCCTCCTATAACCTCCTAAGTCCCACTGA
CAACAGTAGAGACAGAACTGTCTATGTGAATTCTGCCTTT
ACAGAAGATGAGACAGTAAGTCAGCAGTGTCATCTTGAAA
AATCAATGCGCCATTTAACCCTAGGGGATGTCAACTTGAC
AGTTAAGCGACCTCCGCCTTATCAATGGGACTCTCCTGCA
GCAGAACAACTCTGGATACCTCAAGAGCAAAATTTATTGC
CTGGACCTCCACCTCATAAGCCACCACCATTTATACTTAG
CCAGCCACAGCACTTGGAAATTGCACGGCTACCTTTTGTT
CTTTCAGCCAAGCATACCCCCAGTCCCAATTCTATGACTC
TCCCATCACCCTATCAGTTATCTCTTTCACCCTACCCTTC
AGTTGTGGGGCATGGTGGACCTCCACTTCAGCCTTTGCAG
AGTCCTGCACAAACTTGTGGCCCGAATGACATGGTGGCAT
CTAGCCCTTTCAGCCAACCAGACTCAACTTTAGTCCTGCC
CCCTGGTTATCCCTCTAATGTTAGCAATCTAGGTTGTTGT
ACTCTGCCACCAATGTACCCAGGGACTAGTTCCTGCAACA
ACCTTCAGTTGCATCCTATGAGCTTGCATCCTTGGAGCAC
TTACAGCACTTGTCCTCCCATGCCAGACCATTCTGCCACA
CTCCCCAGTAAGACCCATCAGACCCTAGAGAAACCAGTTC
TCTCTCCGCCTCCACCACCTCCACCTCCGCCACCCCCTCC
TCCTCCACCTCCTCTCCCTCCTCCTCCTCCACCTGTCGAA
CACTTGAACCTCCAGAGCACCTCAGAAGTGGTTGCTGAAT
CTGGGGAAAGCTTTCAGGATCAATCCTCTCTCAATGAGAG
TCCACAGGGAGCAGAGAGGTTCAGCAAAAAGGGTCGTAAA
AGGCTTGACAGTAGGGCAGAAGAGGCCAATATGTCTGGAG
TCTCTGAAGGTAAATCAAAAAAAGAGAGTCGCACTCTCTC
TGACTTCAATTCCCTGATCTCCAGCCCAAGACTCGGCAGC
AGGGAGAAAAAGAAGCCTAAAGGACAGAAGGAGCCACTAA
ACAAGACCAAGAAACTAAGCAGGACATCCAATGAGTTCCA
GGACAGCTCAGAGAGTGAGCCTGAGCTGTTCATTAGTGGT
GATGAATTAATGAACCAAAGTCAGAGCAGCAAGAAAGGTT
GGAAGAGCAAGCGGAATTTGCGTACAGCAAACGAGCTTGA
GGAAATCAAGTGCCGCAAAGCTAACGAGAGAGAGGATCGC
AGTCTTGGCAGCCAAGGCTTTGTTTATGTCATGGCCAACA
AGCAGCCATTGTGGAATGAAGCCACCCAGGTTTACCAGCT
AGACTTTGGAGGACGGGTAACGCAAGAATCAGCCAAAAAC
TTTCAGATTGAGCTTGATGGACGTCAGGTAATGCAGTTTG
GCAGAATTGACGGCAATGCATACATCCTGGACTTTCAGTA
TCCATTCTCAGCAGTACAGGCATTTGCCGTAGCCTTGGCC
AATGTCACTCAGAGACTTAAATAGAAATCTTGTCCATGAG
AACGGATGGGCTGAAAAAGAGATTATTGTTAATCGCAGTT
TGTGAGAAATGTTACACTCTCTGCTGCCATAACGTCTGTG
CAATGCCGGTTAGTAGCCGAGAGATCTGGTCACTCTCAGG
CAGTGCAAGTCGCACACAGGTGGTCCGACAATAGATTTAG
TGCTTTAAAGTACCCTTTTGTTAACAGAGGTACAAACTGA
TTTCTGAATGGTGGTACACATCTGAGAGAAAACAAGTATG
TGTGTATTGATGGAATATTATTCAACTTACTTATATTGTT
TTTTCATGTATTTCCTTGGTATACAATGGTGTGATTTTAA
ATGTACTAAAAACTGAGATGGATGTTAGGTTATGGGATTT
GTTTTTGTTCTTCCCTCTCTTGATAACCCACCTCCTTTTG
TTTTGTTTTTGAGATATACGTGTGCCAAATTTAAATTTCC
TATTTACAATGCTTGTAAAATGATGGATTTTTGATTATCG
TTTGTGGTCAGTAACTCAATGAAATCTATATAAAGGAGAA
GCATCAACTTATGTTTGAATATTTTCATCCCATGACTCAC
TTCCATGAAGTGACAGCAGAGATAATATATTCCAGTTCAT
TTTTCCCAATTGTGCCACTATAATGAATGCATTTCTATGG
TTTAAAACTCAATTTAACATGTTTCTTCACAATATGTCTT
AGTTATATTGCATTATTTGCACACTGTGTTCTTGCAGTAT
CTTGATATTGTCCTATTTGAATGATTTTTGCTTTTTAATC
TTAACAGAAATCAAAGTTTTTTAATTACTTTCAGATATAT
TGTCACGTAAGTGACATGACAAAAAGTGCTGTAGTTAGAT
GTACTGAAAATGTACTCATATCATCCGTGACACTTTAGCA
CGAAATATATAGTATGCATTAAGCATTTAGCCAAAAAATG
TCTTATATCAATATATAAATCAGATTTAACACACTGTATA
TTATGCAATGAATGAAATCTAATTGAAACTGAAAGCTGAT
ACGATTCTGCATTCCTTTGTTAAATGCTCAACCCCAATGA
CATAGTTTGATTTCTATAAAGGGGCATATTTTATTATATT
CAGTCATACTGGTTACATATTTATTTTTCTGTATTAATAT
TTAATATTCTACATACATATTTAATATTTGTTGCAATGAA
TCATCAAATTAATTTGTCGGTTGTTGCTTACTTTCCGGCG
TTTTCCAGTAGTTTCATCAGTTTTAAGCCAAACAGTGGTT
CAGAGTCGGGTAGTGTTGATATGGTTGATGTTTTAAGCAC
TTCTTGATTATTCTTGATGTTGTATGCTTTGATGATTTGC
AGTTGCAGTTATTTCTAGCCACTTTGTACTGGGTTATTCG
GGCCCGGTTTAAATTATGTGGAATGTGAGGCTTTAACTGT
GCTTTATCGCTTAATTATTCTGATGTACATTTACAAAATG
TAATTCAAGGGTGTCTTGGAAAAGCATTAGAATGTCTGTG
CCCAGTAGGTTTTAAGTCACTAAATAAAATCTAATTAGTT
TGATGAAATCTGTGTGTATTATTGTTGTTGATGTTAACTG
TGACATGGTGACTCGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tulp4b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000055224 (1),  Ensembl_Trans:ENSDART00000155957 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)