header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-2235
Transcript Name: ccbe1-202
Previous Name: ccbe1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055164 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055164|OTTDARG00000038499|ZDB-GENE-090506-7 ccbe1|OTTDARP00000043263 ccbe1-001 LG_ BX548051.11 Danio rerio protein_coding KNOWN, 317 bp
GGAATCTGCGCGTGGGGCTTCGCAGGAGGTAACCAATCAA
TACTCTCCCAATTCCTCCGAAACAAGCGCTGAACTTCAAG
ACTGGATTTAAAGGGACAAATATCTTTTAATCATCTCAGA
GTGTCTGAAATGATCTACCCGGGCAGAGGAGCATCTCTCA
GTGTGGCCGTGGCGCTCGTACTGTTCTCATCGGGAGCTCC
GTGGACTTTCCGAGAGGAGAAGGAGGATGTAGACAGAGAA
GTGTGTTCAGAAAGCAAAATCGCAACGACGAAGTACCCGT
GCGTAAAGTCCACTGGAGAGGTGACCACATGCTACAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccbe1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000055164 (1),  Ensembl_Trans:ENSDART00000165070 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC154643 (1) 1441 bp
GenBank:EH445748 (1) 862 bp
CITATIONS (2)