ZFIN ID: ZDB-TSCRIPT-131113-2212
Transcript Name: si:dkey-195m11.11-201
Previous Names: dkey-195m11.11-001, si:dkey-195m11.11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055088 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055088|OTTDARG00000038448|ZDB-GENE-131127-648 si:dkey-195m11.11|OTTDARP00000043205 DKEY-195M11.11-001 LG_ CR753817.13 Danio rerio protein_coding NOVEL, 2141 bp
TTAAGTGTTTCATCAGTTGGGTATTTCAGCTCTTCTTGTT
GTAGATTTCACCAGTAAAACTTTCTTACTGTGCTACAGTT
TCATTTATTGTGTCTTGTCAGGATGATTCTCAACAACATA
AGAGCGTTAACTGTGGTGTGCTGGATAATGTGTGTGAGAA
GCACTGTGTCTCAGGCTCCTACACTGAATTTTCCATACAG
TGTGAATCCAAATAAGGTTGCTTTAAACACTCCAGTACAG
TTTAGTTGTAACATTCCCAGATATTCTCCGTATCCCATGA
CTGTGTCTATTGGCAAACTGGAAAACTCCTCACAGACGCC
AGAGAGCACAGTATCCTGGTTGACGTCGGAGGTCATACAT
TCAGGAAGTATGTACTTCACAATTCCTGCAGTCAGTCAAT
ATGAAGGCAAATTAGTGTGCTGGTACAAATCCACCAAGAC
TTCACTGAAGAAGCCATATTCTGAATTCAGCAACCCTGTT
GACTTCATCGTATCTGCACTCTCTCCTCCTAACATCACTG
TGAACCCCGATTTCTTTCTTGAGGGTGGCAATTACACTGT
GTCCTGTAATATAACCCCAAACACATTGACAAACTACACA
ATGAGCCAGTTTTACCGCTATCTCCCCTTCACCCCTGCAA
ACAACTGGACATTGCTTGGCTCTTCATTTCTCACAGACAT
CAGTAGTACTTATTCAAGTCAGAAGAATATGTTTGTCCCA
GTGGAGTTCGCCTGCTCTACGGAGATGGTGTACAATGGAA
AAGTCCTACACTCACCCCTGGCTACTAAACAAGCTATCCC
AGAAAGTCTTCCGGTTCAGCTGTGGGAACAAAGGCGTGGA
GAGAGCTGTATGGGATATCTGAATATAAATCTGAAGTTCC
AGTGGAGGCCTGTTTGTCAGAAGCCATTGGACACTGAAGC
TGTTTCTCAGGCTGCTGCCACCACAGCTTCAGTGGTGTGC
AGGGATCTAGGATGTGGGCATATGCTGAATTGGCAAAGGC
TTTCAGATAGCACAAGGCTGTTCACGAACACAATTGGGGA
CATCAAATGCAGCGGGAAAGAAAATAAGATAAAAGATTGT
TCATTAAATGTTACAGAATCATGCAAAGAGCAAGGGACTC
TCTTTATCGTTTGCTCAGATGCAATGCCCCGTCCAAAACT
GTCTGTGTTTTTGCATGGTCCTGTCTCCAAACTGTATGTC
ACAGATAAACAAGATGTGGAACTCGTCTGCTTTATCAACT
CTACTCTTTTAAAAACACAAGACTATGGGTACTACATATT
TAGAAAGAATGGTCAAGTCTTTAGGGAAATCTACACCCAA
CCTCAATACTTGAAGTCTGTCACACTTTCTGCCCCAGTAG
AAGGAGAGTATGAATGTGCATTCCAGCTTGATTCGTCAAA
AATCAAACAAGTGTCTCAACCCAGCAATAATGTCTTCATT
TACATATACAATCCACCGGCTACAATGCCGATTGTTGCTG
GTGTTCTCACAACTTTAATCGGGACAGCAATTCTGGTGTA
CATTTGTGTATGCAGAACTGCAAAAGAAGAGGTACCAGCA
CATCCCCAGGACCCAGAGACAGCACAGATCAGTACTGAAA
ATTCACAAAACAATGCAGACTACTTACCACAGCAAATGTA
GGACAAAACAAATTAATTATGATAAAAATATGTTTACTCT
CTTGACCATGAAATATGATACTTGAATAATGGTAAAATAA
TGTTAAGAGATTTGTATTTTGCTAAAGTTTACCTGGAAAG
ATTCATTTGAAGATAATAATTATGTGGGTGTGGACACACT
TGATATGTTCAGTTCAGATAATTCTAACTATGTAGTGATT
GCTCTGCTAGTGTTTTTCAACCACTGAAAAGGATCATGGT
TTGATTTAAAAGTAAAGTAAAATATAAATGAGGTATGCAA
GCTTGGGAAAGGCAAGATAAAAAAAAAATAACCGATTTTT
AAAAGTTTAGTGTTTTCTGTTTTGCATTTTTAGTGTTGCT
ATTAAATGGCAGAGTGAAGCAAACCAGGAACTGAATTTTT
TTATTTTTTTCCCTGCATGGTTCAAACAAACCAGGAAGAC
CAAACTACAATTATATGAACAGATTTTTTTTTTTTTTGTA
AAATGGTAACACTTTACACTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-195m11.11-201 Contained in:
OTHER si:dkey-195m11.11-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055088 (1)
  • Ensembl_Trans:ENSDART00000155700 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA473478 (1) 972bp
    GenBank:CA471287 (1) 893bp
    CITATIONS (2)