ZFIN ID: ZDB-TSCRIPT-131113-221
Transcript Name: jmjd6-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: artifact
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050034 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050034|OTTDARG00000035195|ZDB-GENE-040426-17 jmjd6|no_translation jmjd6-002 LG_ CU463857.9 Danio rerio protein_coding KNOWN, 3116 bp
AACTTTAGTTTATTATCAAGCCTTCAGTATAGCAACCACC
TCCGTCTTCTGAAATAAATACAACTTAATTCCGGTACCGC
GTACAGTCTAGTCTGCGGCTAAAGAGCCGCACACACATCT
ACAAAGGCCTCCAGTGACTGACTAGCGTCTCCAGACTCCA
TAGACTTTCACTACAGCACAGTTAGCAATAGCACGCGAAG
CTAAAAGGCGTCGCGCAAAAGACAAAACGCGTCGAAACGG
CGAAGAATGAACCATAAAAGCAAGAAACGGATCAAAGAAG
CGAAACGGAGCGCCCGACCCGAGCTGAAGGACTCAAGCGA
CTGGACCAAACACGAATACTGCAAGAGCTTCGACCTGTCG
CACAGGAGCGTGAAGGATAATGTGGAGCGAGCGGACGTTC
AGCGGCTCAGTCCAGAGGAGTTCATCCAGCGCTTTGAGAA
GCCTTATAAACCCGTGGTTTTGCTCAACGTCGAGGACTCG
TGGCCCGCTCGTGAAAAGTGGACCCTGGAGAGACTCAAGC
GCAAATACCGCAACCAGAAGTTCAAGTGCGGCGAGGACAA
CGACGGTTACTCGGTCAAGATGAAAATGAAGTATTACGTT
GAGTATTTGGAGTCGACTCACGACGACAGTCCGCTCTACA
TCTTCGACAGCAGTTTCGGGGAGCACGCCAAACGCCGAAA
ACTACTGGAGGACTATCAGGTGCCGCTTTTCTTCAGAGAC
GACCTCTTTCAGTTCGCCGGAGAGAAGAGACGCCCGCCGT
ACAGGTGGTTTGTAATGGGTCCGGCCCGCTCTGGGACAGG
CATCCACATCGACCCACTGGGCACGAGTGCATGGAATGCT
CTGGTTCAGGGCCACAAGCGCTGGTGTCTCTTCCCCACAC
ACACACCCCGTGAGCTCATCAAGGTGACACGGGACGAGGG
AGGAAACCAGCAGGACGAGGCCATCACCTGGTTCAACGTC
ATCTACCCGCGCACACAGCAGAGCACCTGGCCCGACGAGT
TCAGGCCGCTGGAGATCCTGCAGCGCCCTGGAGAGACCGT
GTTCGTGCCCGGTGGATGGTGGCATGTCGTCCTCAACTTG
GACACAACCATTGCCGTGACCCAGAATTTTGCAAGCACCA
CCAATTTTCCCATTGTGTGGCATAAGACGGTGCGAGGCCG
ACCCAAACTCTCCAGAAAGTGGTACCGGATCCTGAAGCAG
GAACGGCCTGATATTGCTGCTATAGCGGATAAAGTGGATC
TGCAGGAGTCGACAGGCATCGCCTCGGATAGCTCCAGCGA
CTCGTCCTCATCCTCCTCCTCCAGCTCCTCTGACAGCGAC
TCCGAGGCTGACTCGGGCTCTGAGGGCGACGCCATGACCC
ACCGCAGAAAGAAGAGGAGAACAGGAGGCATGATGGGGAA
CGGTGACATCACAAGCCAGGACGACTGCGCCAGCAAAGAG
CGCAGTTCATCCCGGTGACAAAACTGAGGAACCTGAACTA
AGTATACCAAGAAGTGTGCTTGCGGGAGGAGCATCGCATG
AATGGGAGGATGAGGGGGAAATCGTCTTTTTTGTTGTTGC
CTTTGCAGATGTCAGGCTCTGGACGGCGAGTATGGTGTGT
CCTCCGGTCCCAGTGCCAAGATCATTGATCAAAACGAGAC
GCTGTTTGTGGATTTCACAGGGGTTATGTTCAGATTTCTG
GTGAAATGTGAGACTATACGGTTGAGCTGTGGCGCAAAGT
TGTATAAGAAATTGATTCTGAGATTTTCAAAATGCATCTC
TGTTCTCTCACAAATTTATTATGAGCTTATTTTTATGAAC
AAATGGCACTAGCTATCTTTTATAACAAGCCCAGAAGGCC
ATCTGCTGATTAAACATTGCCTAGAGCGCCATTTGCTGAT
TTAAAAAACTAGCCTAGAGCGCCGTCTGCTGTTGAAAACT
AGCCTAGAGCACCATCTGCTCTTAAAACTACCCTAGAGCG
CCGCCTGCTGTTTCAAAACTAGCCTAGAGCGCAGTCTGCT
GGTTAAAAACTAGCCTAGAGCGCCGTCTGCTATTAATCAC
TACCGTAGAGTGCCGTTTGCTGTTAAAAACAAACCTAGAG
TGGCATCTGCTGTTACAACTAGCAAAACTAACAGCCGACA
GTGCTCTAGGCTAGTTTTGAACAGCAGACGGCACTCTAGT
TATCAAAAAATGCTGCTCAAAGCTAGCCTAGAGCGTTGTC
AGCTGCTCAAAGCTAGCCTAGAGCACCATCTGCTGCTCAA
TACTAGCCTAGAGCAAAACTAGCCTAGAATGCACCGTCTG
CTGCTAAAAACTATCCTAGAGCGTCGTCTGCTTCTCAAAA
CTAGCCTAGAGCAAAACTAGCCTAGAGCCCGCTGTCTGCT
GCTAAAAACTAGCCTAGAGCGCCGTCTGCTGCTCAATACT
AGCCTAGAGCAAAACTAGCCTAGAAGCGCCATCTGCTGCT
CAAAGCTAGCCTAGAAGCATTGTCTGCTTTTCAAAACCAG
CTTAGAGCGCCGTCTGCTGTTCTAAACTTAACTCATTCAA
GAGAAAATATCGATTTTTCAAAATGCAGACTTCATTTCTT
AGACGATTTTTCCCCACAGCTCTGTAATGCGGTTTGGCCT
GATGTGTAATGCTGCCTTTAGCTCTATGAACATAGATTTA
TTTTATTACTGATTTCTCTTGAGCTGCACTTAAAACCTGG
GTTTCTTGTCTTGCGGTTTGCAGGAAGAACTAGCGCATAA
CAGTTAAGTTCACCCTAAAGTGAATATTGTCATCATTTAC
TCAACCTTCCACTTCTTTTCTGAGTTTCTTTCTACTGCTA
AACACAAACAGATAGTTTGAAGAAAGTCCTATGGTCGCTA
TTGATTTCTGTATAATTATTTTCCAGCTATGGATATCTCC
TACTATGGCATTTTTTTTCCTTCAACATTCTTCAAAATAT
CTTCTTTTGTTTTCAACAGTGGGGGACAAAACGGGTTTAG
ATCCGCTTGAGGGAGTAAATAGAGGGTAAATTAAAAATGT
TTAGGTGAGTTATCCCTTTAAAACTGTTAAACTGCTTTTA
TCCCTTTTTCAAGTCTAAATGTCTCATTTTTAGAAAAATC
ATTTAACTATTAAAGCAAAATGGGAATTAATCAGCA

jmjd6 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA jmjd6-002 3116
mRNA jmjd6-201 (1) 1523
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jmjd6-002 Contained in:
OTHER jmjd6-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050034 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC057498 (1) 3142bp
    CITATIONS (1)