ZFIN ID: ZDB-TSCRIPT-131113-199
Transcript Name: si:dkey-43p13.5-201
Previous Names: dkey-43p13.5-001, si:dkey-43p13.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049867 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049867|OTTDARG00000035084|ZDB-GENE-131121-510 si:dkey-43p13.5|OTTDARP00000039127 DKEY-43P13.5-001 LG_ BX908797.10 Danio rerio protein_coding NOVEL, 1107 bp
GTGTCTGGAGCTTTTCTTCTGGAGTTTGCTGAATTTGGTC
ATGTTTGGCGCTGGGCATTTGGTGTCTCCTCTGTCTCCTG
CAGTCTTCCACTCTCCGGCTGCTCATTTCTTCCCAGCGTT
CCCCAGCAGGTTGAGTTCTCCGCAGATCTTCATCCCTGGG
CCTCTGCTCAGCTATGAGCTCCTGCGCAGTTACCTGCAGC
CTGAACCCTGCAAGCAGAGCCTGCTGCTGGCCGCTCATCC
GTCCTCAGGACACCCTGCTGACAACATCGATGAACCGCGG
CCAGTGAAGCAGCGGCGGGCGCGGGCGAACTACAGCAGCT
GGCAGCTGGAGGAGCTGGAGAAGACCTTCCAGAGCACACA
CTACCCGGACATCTTCATGAGGGAAGCCCTGGCGCTCAGA
CTCGACCTCATAGAGGCCCGAGTGCAGGTGTGGTTCCAGA
ACCGTCGGGCTAAAATGCGTCGTCAGCTGAAGCTCCAGAT
CCAAACAGGGGAGCAATGCAGCCAACGGGACACTGACACC
AGACACCCCGAATCATCCATCAGCAACCCAGAGCTCCACA
ACAACAGCCCCAGCCCATGCTGGGACAGAAACCAAGACAG
AACAAACCCTGCTCACCCCAAACCCTCGCCCTCAGCCATC
CAGAGCCCCGTCACAGACCTGCTCCAAGACCAGCAGGACC
CTGAGGCTCCCGGTCCGGAAGATCTGCGGTCCTGCAGTAT
TGCCAAACTTAGGGCGAAGGCCAGAGACTATGAGGCTGAG
ATTCACAGCACTGTGGCCAGAGAGAGGAAGATGAAGAGAG
TCTCGGACAGAGACTGAACTGACATTCACAGGAAACACAT
CTCTAAACTCATTATTTATTACACACACACAGCGAGGTGG
AAAAAAGCAAAACACAAATAAAATAAAATAAAAAGTGCTG
GGTTCTTGCTGATATAATCTGGATTACAAACTAAACACTT
GTAATTTGATTACATTTTAAAATGGTGATAATTATATTAC
TGTACTTTTTTGGTGCGTGATTACTGTATATGTTATTCAC
ACACTGTAAAAAATTGCTGCCTTATTTTTTTAGCTGAATT
AAATTAACTTTTTTGTCATCAATCAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-43p13.5-201 Contained in:
OTHER si:dkey-43p13.5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049867 (1)
  • Ensembl_Trans:ENSDART00000163579 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC067706 (1) 1115bp
    GenBank:CD752782 (1) 873bp
    GenBank:CD282166 (1) 631bp
    CITATIONS (2)