header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1719
Transcript Name: si:dkey-56f14.4-003
Previous Name: dkey-56f14.4-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048549 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048549|OTTDARG00000034332|ZDB-GENE-131121-272 si:dkey-56f14.4|no_translation DKEY-56F14.4-003 LG_ CR848666.4 Danio rerio protein_coding NOVEL, 439 bp
TGCATTTAAAGGAATAGTGCACCCAAAAATGAATTTGACC
CCATCATTTATCAGGTCATTCTTGGTGTATATGACTTTCT
TCTTTCAGACAAACACAGTTGAGCATTTAAAAGTGCATAA
ATCCTATAAAAACCGGAAAACTAACCCCTACGACACCAGG
GGGGTAACTCTTTTCTTATAAAGCAGATCGATGTGTTTTT
GTATTTATAATATTTATTTTTTTTTCAAACTATAAACTAT
TCCTTTAAATTTGCTTCTTGTTCAATCACTTTGCTGTAAT
TCATATTAAGCCTGTTATAAGCATTTCTTTTGATATGGTG
TTGTTAAAATATTTAAACGTGTGTACAGGGTCATACACGC
ATCTTGACCAGAGTGCCTTTCATTATGATTATGAGACGTT
GCGGACCACGGGGGTCATCCTAGCTGTGGTTATGTTTGT

si:dkey-56f14.4 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-56f14.4-003 439
mRNA si:dkey-56f14.4-201 (1) 1009
si:dkey-56f14.4-203 (1) 1689
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-56f14.4-003 Contained in:
OTHER si:dkey-56f14.4-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048549 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD583281 (1) 500bp
    CITATIONS (1)