header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1690
Transcript Name: myom3-001
Previous Name: ch211-135d14.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047735 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047735|OTTDARG00000033864|ZDB-GENE-080326-1 myom3|OTTDARP00000037478 CH211-135D14.3-001 LG_ CR293507.10 Danio rerio protein_coding PUTATIVE, 1788 bp
ATCGGGGTTGATAATGACGGCTTCATATTCCTGAGTTTTG
AAGCTCCTGATGGCACTGATGAAGGAGTCTTTAGTTGGAA
TAAAAACTATGGAAAAGCCATTGATGCCGGACGAGCCCGA
CTGGAGAACAAAAACAACAGGTCTGTTCTCACCTTCACAG
CAGCGGCAGAGCAGGATTTAGGCCTGTACACAGCGGAGCT
GAGTGGAAACCCTGACGTCTCCTCCAGTTTCACCTTCACT
GCAGACGATCTGGAGAGGCTGACAGAACTCAGCTGGCACA
TCAGAAACCCCTTGATCGGTTTGCGCTCTGAGGGCTGGCA
GGTGGAGGTGTCAGAGCAGGGATCGGTGCGTCTGTGGCTG
CAGACTGAAGCTCTTAGCAGTGCTGCGGTGCTTCGGCTCA
TCCTGAATGACAGAGAGATCTCCAGCACACCGACTCGCAA
GATCAACTTTGACAAGGCGCAGGGTTTGGTGGAGATCCTG
ATTGAGCAGATCTCAGAAGAGGACGAGGGCTCGTACACCG
CGCAGCTCAAAGACGGACGCGCCAAAAACCAGTTCACACT
CGTGTTTGTGGATAAGAAGTTTAAGGAGACACTGGCCAGA
TCTCAGGCCAACAGAAAGAACTGGAAGAGAAAGTCAGGTC
CACATTTTGAGGAGTTTCTGTCATGGACTGTGACCTCAGA
CTGTGATATGATCATGAAGTGCAAGGTCACCAACACGAGT
AAAGACACACGTCTGAAGTGGTTTAAGGATGGAGTGGAGC
TTCCTCAGGCTGTGTTTGAGCCCTCGGGTGTCAGTACACT
CACCATATCACAGGTGACCAGGAAGGAGTTGGGGGTGTAC
AGAGCTGTAGTGAGTGACAGCAGAGGAGAAGACGACACTA
TCCTGGAGCTGATAGATGATGAATTTGACCGTCTGATGCT
GCAGCTCAGTAAACAGTGCGTGCTCTCCGCTGGTCCAGTG
TATATCCAGTGCACTGCGCAGGGCTTCAAGCTTTACTGCT
CCCTCAAATACTACCAGAGCTACATCAAGACCAGCTGGCA
CTTCAAAGAGCGCAGGATCGATCTGGACGAGCGCTGCCGG
CCCGGCTCCAGCATGCAGAAGCTCTGGATCGAGATCTGCA
ATCCCACTGAAAACGATAAAGGCAAATACACACTGGAGAT
GTGTGACGGTCAGGACACACACAAGCGCTCGCTGGATCTG
TCTGGACAAGCGTTTGCTGATGCTCTGCTGGAACACCAGA
GACTGAAGCAAGTGGAGTTTGCGGAGAAGAATCGAGCCCG
AGTCACGAAGGGTCTTCCTGATGTTGTGGCCATAATGGAG
GACAAGTCTCTGTGCCTGACGTGTTTTGTTGACGGTGATC
CTGCGCCTGAAATGTTCTGGATGAAGAACGACAGAGAAAT
CTCGTCCGCAGCCCAGTACAACATTAAAAACGAGAACAAA
TCCTCCACGCTCACCATAAACCACGTCAGCATGGAGGACT
CTGGGAACTACAGCATCTTCGTGCGCAATAAACACGGCTC
GCAGACGGTCCTGGTGACGGTCAGTGTGTACAAACATGGG
GAAAAACCCAGAGGAGACGCAGTGCAGATGTAAAAGCCAC
AGCAAACACTGATTGGTGAAGGAGTACACTATATTTACAT
GTGTGATATGTATGACGGTGTTAAAGAGCAGGTCACATGG
GCTTTAGAAAAATATCCTGTATGCAGTTTTTAATGTAGCT
GTCAGTTAATGTAAACAATTTGCAAAGTTCCTCATAAAAG
TGCTTGATAAATAAAGATGTAGTCTCTC

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myom3-001 Contained in:

Genome Resources: Vega_Trans:OTTDART00000047735 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB891528 (1) 616 bp
CITATIONS (1)