header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1388
Transcript Name: si:dkey-192l18.11-001
Previous Name: dkey-192l18.11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059239 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059239|OTTDARG00000041074|ZDB-GENE-131121-477 si:dkey-192l18.11|no_translation DKEY-192L18.11-001 LG_ BX005461.9 Danio rerio sense_intronic NOVEL, 886 bp
GATGATGATGATGAGGCGGCGCCGCCGCAGGTCCTCTTCG
TCGCCTCAGCTGTTTGTAATCAGGATCGGAGCTGACTCGT
GCAGGATGGTAGACGCGTGTCTGTCTGTGTCCAGGAGCAG
GGTTGGCGTTGTCGTCGTGGATAAAAGTAAAAGGCGGTTG
TCAGCAAAATGCGCGCGTTGCTATTTATTGTCAGTTTAGG
TAAGAGAAGGTTCGGTCGACTTTATTGAGAAGACGCGGCG
GCGTTCGGTGGAGCTGGCGGTTCGCTTTTAGAAATAGCAG
CGCGTTGATTAATTAAGGAATGAAAGTAGTTTGAGCTGGC
GTGCTGGCGGCGACCAGCGAGAAAGCATTCGAGCAGTTTG
GATCCAAAGCGTTTGATTTGTTTATTGTGAAACAATCGGC
AAAGTTAATACACGACAGTTGTTCTTCCGAACGGCAGAGG
GCGCTGTGCGCTGGCGGCCTATATATACATCGATCCGCCG
TAGAGCGAGTCAGTTTGTTTGGCGTGCGCGGCGTGGAACT
CGTGCACCGTGGGCTTCTCCTGGCTGCTGTACTGCAAGGA
TTTTTGGAGTCGGCTCGTGGTGTTTTTTCCTGAAAGCGTT
TTAGGCTTGTAAGCTCGCGATGGGATTAAATAATGTTTGC
TCGTGTTATGGAGAGGCGCAGGGAGCGCTGCCGCAGGAGC
GCGGCTGTTGACGGATTGTTATCTGGAGCCGACGGAGGAC
GCGGACACCGGGAACCGAGAGGAGTCTTTACTTCGTACTC
AAATGTTCAGCCGGCGACGAGTGGACTCGGAAGCAGCGAT
TTGATGTTACAACGGGTAGTAGACAAGAAGTTGTTTGTGT
TCGGTTGTGGAACGTGCGGCTAATAAAAGTCATGGATGTA
TCTGAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-192l18.11-001 Contained in:
OTHER si:dkey-192l18.11-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000059239 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DV585129 (1) 810bp
    GenBank:CO922952 (1) 801bp
    GenBank:EH546872 (1) 495bp
    GenBank:EH568009 (1) 476bp
    GenBank:EH492341 (1) 419bp
    GenBank:EH518666 (1) 402bp
    GenBank:EH520644 (1) 401bp
    CITATIONS (1)