ZFIN ID: ZDB-TSCRIPT-130528-66
Transcript Name: chac1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058371 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058371|OTTDARG00000005140|ZDB-GENE-030131-1957 chac1|no_translation chac1-002 LG_ AL929049.4 Danio rerio protein_coding KNOWN, 811 bp
ATCATCCGCCGAGGACGAAAAGCAGCGCGGCAGCCCGGGG
TGCGCGAAAACAACGGTTAAAAGGTTATTCGATCCGCCTT
TACAGCACCGTATGATTGGCCGGGTAGAGGTTTGTTGATA
AACAGGAGGCTGGCCGGCGAGCTAGCAACAGCTTTTTGTG
TTTTATTCCGATTGAAAGAGCCGAAAAGGCCAAGATGGAG
TTTTAAGGCAATGATGCGGTAACTGCACGGCATAGGCATG
CACCAGGCAAAGAAAAGCGTTTTGCGAGACTGCACCATCA
CAACTGCTAAGCAGTTGGGCTCTGATACCGTCCGCGGTAT
AGCCGTGAGCCAACCCATACCTCTTCTCCTTGATAGGAGG
AAGCTAACGCTAGCTACCTAGCCTGTGGCCCATTCATTTA
GCTGTTTTTACATCAAAGCGCACACTATTACCTTTTCTAC
ACTCATACCATCCTGTAAAAGATGAAACCTCAAGACATCG
TCGCTGGAAAATCCAGCTTGTGGATCTTCGGCTACGGCTC
GCTGGTCTGGAAGCCAGACTTCAAGTACAAGAGGAGCAAA
GTCGGTTATATTAAGGGGTACAAGAGACGCTTCTGGCATG
GGGATAACTTTCATCGTGGAGATGATGAAATGCCCGGAAG
AGTGGTGACGCTCATCGAGGAGGATGACGTAAGTGGAACT
TCCTTTTTTATTATTAGGAACAACCAACCATACATGTACA
TACACGAGAGCCCCGTTGGCGGCTATTTTTACAAGCTATT
TCTTAGGACATCTATAGATGCCACCCGGAATAGGCATCCA
CCATATTGGAA

chac1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA chac1-002 811
mRNA chac1-201 (1) 1562
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
chac1-002 Contained in:
OTHER chac1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058371 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH436708 (1) 840bp
    CITATIONS (1)