ZFIN ID: ZDB-TSCRIPT-130528-578
Transcript Name: ablim2-202
Previous Name: ablim2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058385 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058385|OTTDARG00000040602|ZDB-GENE-100316-5 ablim2|OTTDARP00000045646 ablim2-001 LG_none CR848021.10,BX465854.7 Danio rerio protein_coding KNOWN, 3234 bp
GGCTCGTGCAGGGATGATGGTGCTGAGGCAAATACGCACG
AGCGCATCACAGCCATACGCCAACACCCAGTTCGTGCATG
CGCCCGCAACACTGCGCACTACGTTTATTACCGATCCTAT
AGCACACATAACTACTTTTCTAAAATCGGAGGTGCGAGGC
GCTTAGTATTCATTTTTTTTAAACACCCATTGTGTCGGCT
TTAGCGCTCGTGCACCGGGCGGCTGATGAAAGATGTGCAG
CGCGCGCTGAAAGCTGAAGAAGATCTGTAGATACGCATGA
CATTGGGCTCTGGAAAGGTCTGCAGAGAACAATGAGCACC
GCGTTTCACCAGCAGGCTGTCCACAGTCCCCTGGAGCAGC
AGAAGGGCCAGCGGCAGAGTGGCCCGGTCCCCTGTCAAAA
CTGTGGCAAACCCTGCAAAGGAGAGGTGCTCCGGGTGCAG
AACAAACACTTCCACATCAAGTGCTTTGTTTGCAAAGTTT
GTGGATGTGACTTGGCTCAAGGAGGGTTTTTTGTGCGTCA
AGGCGAGTATATCTGCACTGTGGATTACCAGCGACTCTAT
GGCACCCGCTGCTTCAGCTGTGAGGAGTTCATTGAAGGAG
AGGTTGTGTCTGCCCTGGGCAAGACTTACCATCCACGCTG
CTTTGTTTGTGCCACCTGCAAGCAGCCGTTTCCAGCTGGC
GACCGCGTGACGTTTAATGGGAAGGAGTGCATTTGTGAGA
AATGTACTCAGCCTGTGCCAGTCAACAGCACGGCTCCCCC
ACAGGCTGTGCACAATTGCTGTGGATGTGGAAAGGAGTTT
AAAAATGAGCAGTCTCTGGTGGCGCTGGACAAGCACTGGC
ACCTTGGCTGCTTCAAGTGCAAAGTGTGCAATAAAGTGCT
TAATGCCGAATATATCAGCAAGGATGGGATCCCCTACTGT
GAGGCAGATTACCACGCCATGTTCGGCATCCAGTGTGAAA
CCTGCAAGAAATACATCACCGGAAAAGTACTTGAGGCTGG
AGAAAAACACTACCATCCCACATGTGCCAGATGTGCTCGC
TGTGACCAGATGTTTGGGGAAGGGGAGGAGATGTACCTGC
AAGGTTCTACCATCTGGCATCCTCCTTGCAGACAGGCAGC
GCGTATGGAGGAGAAGAGCAAGGTGACGCGAACCTCCTCT
GAGAGCATCACTTCTGCTCCAGCCTCCAGCGCCTCAGGCT
CCCCTAGCAGAGTTATCTATGCAAAACTGGGTGATGAACT
TCTGGATTATAAGGATCTGGCTGCTCTTCCTAAAATCAAA
GCCATCTACAACATTGACAGGCCTGACATGCTTTCATACT
CGCCCTATGTGAGCTATCCTGTGGAGGACAGGACTTTTGG
AGAGTCACCCCAGCAACTAACGCCTACTCCAACTGAGGGA
GATGGGGAAAAGTCTCCCCGTCAGAGGAGGCCCTCGAGCC
CCAGCTCCAACAGCTCTTTAGGAGGCTATGGTCGCTATAC
GCCTTCCCGCTCACCACAGACCTACAGCAGACCAGACCAG
TATCTGAGCATCAAATACACCACCCAGCCAGAAAATTCCC
ACTTGCTCTCTGTACCAACCTCGGGGAGGAGTAGTGCCCA
TGGTAGTGCCAGAGGCTCCTCCCCGCTGCCTCTGTACAAC
AGCAGTGGTAGAAACACACCCCAGGCAGCCCTGCTTCTCA
ACCCCACTACTCTGGCTTTACTCCAGCAGCACAACTACAT
CCCTTACTTCAGAGGTAGTGAAAGTGGGCGCAGTACCCCC
AGTCTCTCCACCTACTCTGATGGCAAATCTCCATCGTCTA
CATATGTGGCAGCCCCACGGCATTTCCATATCCCAGAGAC
TAAAGTCAAAGATAATATCTATAGAAAGCCCCCTATCTAC
AAACAGCATGCTTCCAGAACCTCCTGGCAAGATGGTGATG
ATGTAGACAGAAAGACCAGGACCAGTTGGATGAACCTGAA
GACTGAGATTGATGGACAGTCTCCAGAGCTAGACCCCAGG
ACCTCCACACACAGCCTGCCCACTGATATGTCTCAACCCA
ACTTTCCATATAACAAGTCTGCTTCCCTGCCAGGATATGG
GCGGAACGGCATATACAAGGCAGCTGATCTTGGTGAGGAT
GAGGCAGACCATGATTCATCCTGGAGTGGAATGAGAGAGT
ACAAGGTGTACCCATATGACATGCTAGCTGTGTCCCACAG
AGTCCGAGTAAAACTACCACGTGATGTGGACCGCACCAGA
CTGGAGAGGCACCTGTCACCAGAGGACTTCTACAATGTGT
TTAGGATGACCATTGAACAGTTTGACCGTTTGGCCTTGTG
GAAAAAAAATGAACTGAAGAAGAAAGCCCGCCTGTTTTAA
ACCACGCTGAATCGCTTGAAAGAAAGCAAAGATAAAGAGA
AAACCTCTTCTCATCCGTCCTGTGCGCACTGAGGGATGAG
TGTGAGAGAAATATATATGCACCTCCGTTCTGCTGCATAG
CTATTGCCATCCCATCTCACGCTGAGGAAGAGGAAGTGCT
TTCACAACGCTGTTCGCCACCAAGCTTCATGTGTGAACGC
CACATCACATGGTCTGAATGTTAATCCGAGACTGGAGTCG
GAACTCAATTCTCCACGACTCTCTTTGATTGTGTTCGATT
TCGCTCCCTCGGCTGTCTTTGTGATTACTGCGTTGTATTC
TCTCTTTGTGGAAAAAGCACTCAATATTGATATAAGCCTC
TTTCTTTACATTTTATACAGTTGATAAAACACGGCCAAGC
AGCTCTACTTGTAAATCTTTATGCTGTGTAATAACATCCA
ATGTTCCCACTCCCCTTGTCTTTTGCTATGATTGTCGTCC
AATGTCCTTGTCTACTCATATAGAGTGCATTATTCTGCCT
CCCTACCACATCAGCAGATCTGGTTCCAGAAGTATTTTTA
CCATTCAATTTTCCGATAGGGATTAAAAAAATGTCATTAT
CAATAATTAAATGCTATGTGAAAAATCAAAAGTTTGATTT
GAAACATAAGAGAAAAAATCCATCAAAAGAAAAGGTTTAC
AAAGAACTACAATCTCATGAAGCATTGCAGATGACACAGT
TGAAATCAGTGGAAATATAAAACTCTTCATGTAAAGTTGT
TGGTTGTATATTTATACCCCAACGTCAAGTTAAATACTGG
TATGCAAAATTTTCAGGTATTTTGATTGTTCACAGCTGGT
CCTGCATCAGTTCACGATTGATTTACCAATCAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ablim2-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058385 (1),  Ensembl_Trans:ENSDART00000152879 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL910542 (1) 539 nt
GenBank:CR927600 (1) 539 nt
GenBank:AL910543 (1) 524 nt
CITATIONS (2)