ZFIN ID: ZDB-TSCRIPT-130528-558
Transcript Name: si:dkey-85n7.9-002
Previous Name: dkey-85n7.9-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058324 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058324|OTTDARG00000040570|ZDB-GENE-130531-38 si:dkey-85n7.9|no_translation DKEY-85N7.9-002 LG_ BX255913.8 Danio rerio antisense NOVEL, 608 bp
ATTTAAAGTAACGTACTTGGTTAAGAACAACGTATTCCGT
AATTTTGTTCACCGTTAGAACTGTTAGAATTTGATCAGCC
TCGGAGGAACCGGAAGCTTGTGAATTTTCTTCAGTCTGTT
GATTCCGAGGAGTGTACGGATTTTCAGTCTGCACAGCTGC
ATGAGTGGGCGTGGAGGCACTGCAATCAAAGGCAGCAAAT
GAATACACAGGTGACTCAAATCATCTGCATAAATGAATAA
TTCACGCTCAAGGTATGGGTGCACATACTTGCTTTCTCTT
TGATGCACTGCCACTCGTGGTAACTGGATCTGTTCTTCAT
ATGACAACAGCCATATCTGGATGATTTTGTCTTCAAGCGG
GGGAAGGATTTCATGTTTGACCACCAGCACGCGCTGGCCA
CACAAGCACTCGAGCAGCTCCGGTGGGAAAACGAACAGCA
CATCCCATCTTTTTTTCTCGGAAAGTTAGCAACACTTTAA
TCGCAGGAATCCCTTACTATGTGCCGTCAGCGCACGCGCG
TGTGCAACTGAAAGCGCGTGTGGAAACTGCACAAACAATT
CTGAACACCACGCAAATAAATTAGTGATAGATCAAGCTTT
GCAACCAG

si:dkey-85n7.9 TRANSCRIPTS
Type Name Length (bp) Analysis
antisense si:dkey-85n7.9-001 (1) 1213
si:dkey-85n7.9-002 608
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-85n7.9-002 Contained in:
OTHER si:dkey-85n7.9-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058324 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD598507 (1) 650bp
    GenBank:CD598515 (1) 650bp
    CITATIONS (1)