header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-412
Transcript Name: casp7-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058658 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058658|OTTDARG00000040715|ZDB-GENE-050522-506 casp7|no_translation casp7-002 LG_ CR381684.9 Danio rerio protein_coding KNOWN, 743 bp
GAGTATAGAGCATGTCAGGATCCCAGCACACACCACACCA
CACCAAACGGAAAAAAATCCACGCTTAAATTTGGGATAAA
TTCAGCAGATCTGGAAGGAAGAGCAACACGTTTCAATGCA
GAGTGGCGTACCGTTTAATGAAGAGCCCAGTAAGAAGAAT
GATGGCAAGTTGCAGGAAAAAGGGGAATCTGAAAGCCATT
ACAGGATTGTTTCACCAACATTCCAGTATAAGATGAGCCA
CCAGCGTGTCGGCAAGTGCATCATCATCAATAACAAGAAC
TTTGATGAAAAGACAGGGATGAATGTACGTAATGGCACAG
ACCGAGATGCTGGAGAGCTATTCAAGTGCTTCAAAAGCTT
GGGTTTTGATGTTGCAGTGTACAACGATCAGACCTGTAGG
AATATGGAGCGGCTACTTAAAGCAGTGTCAGAAGAGGACC
ACAGCGACAGCTCCTGCTTCGCCTGCATCTTGCTGAGCCA
CGGCGAGGAGGGCATGATTTACGGCACGGATGGAGCAATG
CCCATCAAGACCATGACCTCGCTCTTCAAAGGAGACGTGT
GCAAGAGCCTCGTGGGCAAGCCCAAGCTCTTTTTCATCCA
GGCCTGTCGGGGTTCGGAGTTTGACGATGGAGTTCAGACT
GACTCGGGACCGCCCAATGACACAATAGAGACAGATGCCA
ATCCAAGACACAAGATTCCAGTGGAGGCAGACTTCTTGTT
TGCCTACTCAACTGTGCCAGGTA

casp7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA casp7-202 (1)    Ensembl 2648
ncRNA casp7-002 743
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
casp7-002 Contained in:
[BAC] CH211-28P3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000058658 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK354879 (1) 835 bp
CITATIONS (1)