ZFIN ID: ZDB-TSCRIPT-130528-305
Transcript Name: si:dkey-85n7.11-001
Previous Name: dkey-85n7.11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058326 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058326|OTTDARG00000040572|ZDB-GENE-130603-59 si:dkey-85n7.11|no_translation DKEY-85N7.11-001 LG_ BX255913.8 Danio rerio lincRNA NOVEL, 368 bp
GTGGAGTCAAACAGGTTGTGTCTTTGGATTTTCAGCACTT
TAATACTTGGAAATGGAAGTTGAAATCTCTTGCGAGATCT
CCGAGCGCCAGAAAGAAGCGCAGCAGGGCAATGAAAGGCC
TGGGAACGGCACTAATAACGAGGAGAAGGAGAAAATGAAG
AAGCAGAAAAAGAAAAAGAAGAGCAGGGTTGGCTCCTTTA
TCAGAGCTGCCCTAAGATGCTTTTGCTTCGCTCCAAGAAA
CTCTTCGATCCGACTTTCACCCTCTGATGACAATGAGAAT
GAGATCTATCAGAATATGATGGTGAAGGTGGAAGAAGAGG
AGGAGGTGGTGGAGAAGGAGGAGGAGATGATGAAAGAAGA
GGATGAGG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-85n7.11-001 Contained in:
OTHER si:dkey-85n7.11-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058326 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO359578 (1) 490bp
    GenBank:EB910892 (1) 368bp
    CITATIONS (1)