header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-842
Transcript Name: si:ch211-190d13.1-001
Previous Name: ch211-190d13.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057876 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057876|OTTDARG00000040329|ZDB-GENE-121214-247 si:ch211-190d13.1|no_translation CH211-190D13.1-001 LG_ BX908756.12 Danio rerio lincRNA NOVEL, 329 bp
GACAGAAGCAACAAACAATTCTTAAAGCTAAAACCGTCAG
TAGTGTAGTTACCAGTATCTTAGCCGTTCAAACTAGAGTC
ACATCATGATGGAGAGGAAGAACTAACAACTTATACTCTG
AACCATGACGTTTACGGTGGTTGGCTGACGTTTGACATCA
TTTCCATGAACCAGCACTCAGAAACACGAGAGCATCAATG
ATGTTGCATGTCCAAAGTCTTACAGATTTGACTTTTTTTT
TTGTCCTGACCTACAAATCAACATGTACTGTAAGTGTAAT
ATTTACTTGCATAATGATTTGTTTCTCACATGGTTAAGGT
GTTTTTTCC

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-190d13.1-001 Contained in:
OTHER si:ch211-190d13.1-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000057876 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB913929 (1) 226bp
    CITATIONS (1)