header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-493
Transcript Name: si:dkey-118k5.5-001
Previous Name: dkey-118k5.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057507 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057507|OTTDARG00000040090|ZDB-GENE-121214-261 si:dkey-118k5.5|no_translation DKEY-118K5.5-001 LG_ CR478288.14 Danio rerio antisense NOVEL, 941 bp
ACAGTTGCTTAATGTCACACGACAACGTTGCTACAGCCTT
CTCACGTCTTAACAATGTAGCGAGCACGTAAGCGGTTAGT
GGTGATGTTGCCTTTGAAAACATGCAACGTTGTACAGACA
TCGCTACAACGTAAATGTGTTTGTTGGCGAAGTGCCTTCT
TAATACGTCTGCAGAAAAGACGCCGCGGCCTGCTGAGTTT
GTTGACAGCTGATCCCATTTGTTTAAGCGCAGACTGAAGA
TATCGGCCTGTTCTTGGTTTGAGGCCTGAAAACGCATCTG
ATCCTGAGAGTGACTGTAGAACATAGTACAAGGCGGCCAG
AAACTCCTGCACGCTGGTGTGGAGGAAATGAAAGCCCTTT
TCTAAGGTGAGGGACGCTCGATCCTCTTTAAGGATCTCGA
AGAGGAACACCTGTGAGAGTTTGGTGCTATCCAGATTAAA
AGAGTTTATATCGGAGCTTTCAAAGATGAATCGTCTCTCC
AGGAGGCCTTTGAAGGCCATCGCCCCGAGACTTTTGAGTA
CTGGCTGCATTTCAGCCAGGACATGAGGAGCATGCTGAAG
CCTGGTGTGATGGGAGCCCTCGCTTCGCCCTTGGGCATGG
AACAGCACGATGGATTTAACGAAACAGCAGTAAATCTCGG
TGATCGTCACAGGTTTGGAGCTCATCTCAGAAGGTATCTG
TAGGTCATCTTTATCGAGGCCTTCTTGCTCTCCTGACTTG
GCATTTACAGGATCAGGATAAAGGCAGGAGCCACCGTCAT
GCAAGGCAGTGGACACAATCCAACAGAATGCGGGAATGTG
GCACATGAGGAGAAGGGGTTTATGGGACGACACTGAGGCC
CAAACTGCAGCAGCAGCCTCAGGAGATCTGCAGTTCTTCT
CAAAGTACTGCTTCTGCTGATCTACAGAGAAACCCAACAG
GCTGTAATACTGGCTGACCAG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-118k5.5-001 Contained in:
[BAC] DKEY-118K5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000057507 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH593548 (1) 947 bp
CITATIONS (1)