header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-297
Transcript Name: rtn1b-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058163 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058163|OTTDARG00000005395|ZDB-GENE-030710-3 rtn1b|no_translation rtn1b-003 LG_ BX088722.8 Danio rerio protein_coding KNOWN, 823 bp
GATACAGAGTGAGCAGCGGAGAGGCTGTAGAAGTAGAATT
AGCAGAAAGCGATTCTCAGTCCTTTTCCTCGCCCAGCCTA
GTATGCAGGCCAGCACCATGGCAGCCGCAGACTCAACCAA
GATGGAAGGTTTCTGGAGCAGCTGGAAGTGCCAGGCAATG
GCAAAGCTGTGCAGGAGAAGTCCCATCCATGCCTTGTAAA
CAGAAAAAAGAAATTAAGAAAAAAAGCAAAACATGCATTT
GTCAAAACTGGATCTAGTCAGAACTATTCGATGAATTGTA
GTAACTTACTATGTAACCTAAGACTATATTATTCAAATCA
GGCGAAAAGGCTAGATGTGACTTTCTTTTTTTTTATGTGT
TGCTCATAAAGTGCATGAAGTCAAGAGTCTCAAGTGCTGA
TGAATTCTCTTTTTCTCTTTTTTAAAGTTTGTGTGCTTTC
TCAGCTGTGCTGAAATCTCAGTAGTTTGTAAAGGATCTCT
CCAGCTTTTTTGCTCTCCAGTGACACTCTCATCTTGGACA
AAAACAGCAACAAAAAAGCTTTTTGTGTGTATGGTGTTGG
GTGGGGCTGTTTTGCTTCCGTCACTATATCTGCAAACATG
ATTAACATAACCGTCATGTCAGCTAGACGCATGGATCTGC
CGAGGTTCATGATTTCTGGGCACAAACGTAACTATTTAGC
AATGTTCTGATTAGATATGGTCAGCTCACTTGTACCATTA
CAGTATTTTCCCTTTTTGTTGTAGGACTCCGCTACAGAGA
TTCATGTTTAGGTGCTGTCATCTTATTTCTTTTTTGAAAA
TGATTCAAACAAAAGAGAGGGAG

rtn1b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rtn1b-003 823
mRNA rtn1b-201 (1) 1836
rtn1b-202 (1) 3525
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rtn1b-003 Contained in:

OTHER rtn1b-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058163 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK398268 (1) 877 bp
    CITATIONS (1)