ZFIN ID: ZDB-TSCRIPT-120702-70
Transcript Name: nlrc5-202
Previous Names: ch211-122c9.5-001, si:ch211-122c9.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055975 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055975|OTTDARG00000039043|ZDB-GENE-120709-103 si:ch211-122c9.5|OTTDARP00000043900 CH211-122C9.5-001 LG_ BX470170.5 Danio rerio protein_coding NOVEL, 6425 bp
CATATGCCCTCTCACTCAGTTAGAATGTACACAGACGACG
AACTTCAGTTGGTAAACCTAATGTTTTGTAAGCGTCTTGC
ACACTTTGTAAGTGACTGATTGTGCTGCTCATTAACCAAA
TAATACAACGTCGAATTTACAGTATGTACAGCATAAACGC
TAAACTTATTTAATTCCCATACGAATTGACTATAAGTTAA
CTTAATAAGAGAATGACGCATTCGATAAAAAATGCTCTGG
GTCGTCATGTGCTGGCCTGAAAAAGTATTAGAAGAGATGC
GGATGCCATGTTTCGTCGTCGATAGATAAAAATGATGTTG
TAGGGTACATTAAAGCACGTATTGGACGCACCAAAAAAAA
AAAAGTTAGCTGATCTGTCTCGCGCCAAAATCCTGGCATA
ATGAGATCCGTTTTTCTTATGCATGTGAATGGAATCGAAA
CCAAACCTGAGCGGGTTGCTTTCATTTTCTCCTTTCAATT
GGACAGATGCGTTATGCCACCAGCGCTAATGGATGAGGAT
GGAGAGGATGGACTGGTCGGGGGACGCCCTGACACTGGTA
GCCCAAGAGGCCAGTGTACTGGTGGACTTGCTCTGCGAAC
AGGATAGTAGTGTTTTGGACCATATCTTTGACTTGTTGGA
ATCTAACACACAGGATGAGATACGATCACTGATCAACAAT
AGAGATCGTGTCTCAGCCATCGTGGATTACTTCAAGACTT
CAGACAATATCACATGTAGAAAGTTTTTCTGCACCATATA
TGAGTACTGTAAAGACATCCCTTTCTATCTTGAAACTACA
CTAGTGTCAATAGCTGGAGATCCAATTGATAATTATTCAT
CATCAAGAAATGTGAAACGTCTACGACTAGATCCTTTACA
GAGCTACACAGATGCTCTGAAGTCCATGGTAAAGGAAAAA
CATAAGACAGTGATGCAGAGTGTGGTAAAGGATATACGTC
TAGATGACACATGGGTGTATTTAAAGCACAGGAACCCTCC
ACGAGCAAAAGACAGGACCCTCCAGCTTCAAGCCTCTCTA
GACAGCCATGAAGGTGAAGAGTCAGAGCACAAAGTGTCCG
TTGAGTCTCTTTTGAAAACCACTGGCAGGGTTGTTGTGCT
GCTGGGCCAGGCTGGATCTGGTAAAACCCTGCTCGTGCAC
TGCCTCGGCCATAGCTGGGCTGAAAACACCTTCCCGTCTA
TTCAGCTGCTGTTTCTGCTGGAGTTCCGGCAGCTCAATCT
GATCTCTCGAGACCTGTCCTTGAAAGAATTACTTTTTCTC
TTCTATCCTGCTTGTTCGTATGTTGAAGAAGAAAAAGAAG
AAGTGTTTGCATTCATCCTCACACACCCGGACAAAGTCTG
CTTCATATTAGATGGTTACGATGAGTTTAGAGCCAAACTC
ACAGATCCTAGAGAACTTGAGAGCACAGTTGATCTGAGCA
CACCCATGCCAATGGCCGATCTACTTTCAGGACTCTGCAG
TCGTAAAATTCTTCCAGATTGCACTGTTTTGGTCACCTGC
AGACCAAGAGATGTGACGGACATGTTTGGAAGCCCTGGGC
TCATAACCTGTGAGCTTCAGGGGTTTGACCGATTGGGGGT
GAAGGAATACGCTGAGCAGTACTTCCATGAAAAAGGAGAT
CTCAAAACAAATGCTGTTAACTTGTTGATGGATAACCGTC
ACCTCTTGTCCATGTCTCATGTGCCTGGACTCTGTCATAT
CTGCTGTATATGTGTGGATCATCTGTTCTCCAGTGGTGAA
GTGTTGAATCATCAGCTTCCAACGTCCTTAACCCAAATCT
ACATCCAGATTCTGTTGGCATTCCTCAGTCGGTTCAATGA
AGATGGAGTGTCTAAAACATCTCTGCTTATGAGATACAGG
ACTAAAATTGTTGAGATGAGCCAACTGGCTCTCAAAGGAC
TGGAAGGAAGCACCATAGTCTTTATGGAAACAGAAGTATC
CAAGGAACTCCAAGATTTTGGTGTCAGAAGTGGGATACTG
TCTCGCGTAAAGCTGACGCATGAGGATGGATCTTCAGGAT
ACGGTTTTACCTTTATGCACCTTACAATGCAAGAGTTTCT
CGCTGCTCTCCACCTCATGACTAGTCAGACAATCACAGAT
GGTCAACTTAAGAAGAAGCTTAACTTGAAAACCAGATGGA
CTACCAAGACTGACCCAAAATCCGTCTTTACAGACTCTGT
CCATCTTTATGTATGTGGGCTTGCAGCAGAGGCCTGTACT
TCCTGTTTGGTGCAACTTAAAGGAGCAGAGAGTGAGACGA
CTTGGGTAAAAAAGCGACAAGCTGCTGTTCGTAATGTTTT
ACTAGGTTTAGCGGGAGGTGCCAGTCATACAGGTCCAAAA
ATTGTGGAGCTGTGCCGATGTGCTCATGAGACACAGGATG
CGAAACTGGCAAAGGCTATTGGTTCGAGACCACAGATTGA
ACTGCGAAATATCAGACTGAATGCTGTTGACATGGATTCC
CTTGCATTTGTAACAGCGGCTGCTGATCAGACTGTATGTC
TAGACTTTGGTGGATGTTCAATTGACTTGGATTGTTTGGA
AATCCTCCCTAGTTTCAAGAATGTGGATCACCTCATTTTC
CGTAGCCGGAAATATGATGACAAATTTGCAGAGACTTTGT
GCGGTATCCTGTCTAAACTCCAGGCCTTGCAACAATTAGA
TTTTATCAGTGGAGGCCTCACCGATGTTGGAGCGGCTAAA
CTTGCCAAGGCGTTGGAGGATTGTCCAAACATCACACACC
TGAATGTCAGTGATAACTCTTTGAAAGATGAGGGTATAAG
AGAGATTGCAGAAACAGTGTCCAGGCTGCACAACATCTCC
TCTATTTTAATGGGGAAGAATAACATTTCCACAGATGGGA
TCCTCACTCTCATTGAGAGAATGGCCGCTTGCACCTCTGT
TCAGGAAGTCCATGTTGAGGGGAATAAAGAGATCAACCTT
AGCTTCTCAAAACGCTCTGACACAATCAGTGAAAGCAAAG
ACTTGAAAAACACAGAAGAGACAAAGAATATAATCTTGAA
GCAGTGTAACCTCACAGTTTCCCATGTGGCCAGCTTGTGT
AATAAACTCAGAGGCTTTGCCATCCTAACGCTTTTAGATT
TGTCCAACAACTCTCTGGGTAACAAAGGCCTGAAGAAAAT
TTTGGACCTTCTGCCTAAACTAGGAGGAATTCAGGAGATA
AATGTCAGTGAAAATGGTGTTGATATGGAGGGTGTGGTGA
TGCTGGCTTCTGCCCTCTGTAAACAGTACAACTTAAAAAG
AGTGGATGCAAGTGAAAATGGAAAGAAAAAAGTGGTTCTT
GGGTTTGACACCACCAGAGGGCATAATTCAGGGGAGCTGA
CTCAAAATGAAACCGGGATGCAACTGCACAAAAAACTGAG
TTTAACCCATAGTGATATCCAACCTGCCTACATGACCAAG
CTGTGTAAGCAACTGGTGAAATGCAAAAACCTACTGGACA
TTGACTTCTCCAATCTAAAATTAACCGACGATTCTGTTGA
GAATTTGATGTTGATCCTTCCTGTCATGTTGTCTCTTCAT
GTACTGAACTTAAGTCATGTTGATCTGTCTACAAATGGGG
CTTTGATATTGGTCAGATCTCTTGCCGATTGTCAGCGTGT
CACTTCTGTCGAACTCAGGCACCAAGCTGAAGCATTCATC
AAATTTGTTCCTGAGAAAGCTGAAGTAGCAATTTGCAAGC
TCACAGAGTATAATCTGAGCAAAACCAACGTCGTGAAGCT
CTCGAAGATACTGGAGAGCTGTCCTCATCTGTCTGAACTG
GACTTGTCTCATAACGTTCTCAGAGATGAAGGTGTGAAGT
GTTTTGTTGACCATTTGCCCAAACTAAAGATCTCCAGCTC
AGTGAGCCTCATTGGCAACCGAATGACTCAAATCGGGGCA
CTGCATCTGGTCAACTCAATGAATACCTGTGAAAAAGTTG
TTGCTGTCGAAGTCAGTCTTGGAGTGGAGGATCAGTCTCT
GATTCAGTTTGTGCAAGAACATGCCAATGGCAAGACTCTT
AGGCTAAGGGAGTGCAGTTTTGAGCTTGCACACTTGAAGA
TGCTTGTGAAAATCCTGACAAAATGCCCAAGACTCCTTTC
ATTAGAATTGTCTTCTAATTCACTGAACAGTCAAGGACTT
TTTTCCTTACTGGATAGCCTGGCTGAACTATCCACAATCC
AAACTTTAACGTTGAGAAATAATGGCCTGAATTCTGAGCA
AATTGAGCATTTTGTTAAACAGTTTAGTCACTGCAACCAA
CACAGAGACATCAGAATCGAAGAGTCGTGGATGACAGGAA
GTGCTGCTATTGGCCTCATTGCGAGATGCCTCAGTCTACA
GCAGCACATCAGAGAAATCAGGGTCCACCGTGCATCTATA
AACATGATCATTGAAGCCAATTCCATTTCCAGCTCCACTT
CAGTCGGTCATTCTGAAAATGTGTTGCCTGCTCTGCAGTC
TATCAGCTTTGATGACTGTGATGTAGAAGGACAGCACCTC
ACTCAACTCGCACTTCCCATCCAGAAATGTCATGCCTTAC
TGGATTTAAAGTTCTCGCCACTTAAATTGGACAGAATAGG
TGCAGAGTTTTTTTCTGCAGTCATTCCATTCTTAAGGAAT
CTCAGGAACATCACTCTGGATCTGAAAGGAGCCGCTGAGG
AGGAAGTGGAAACTCTTGCTGAGGCCCTGCCAAACACTCC
AGCCTTTGAGAGTCTGAGCTTGTCCCAGCTTGTCTTAAGT
GACCGTGGAGCTACACTATTCGGAAAAGCTTTTCAAAATG
TGCCAAATCTGAAGTCATTCAGTATGTTGCAGTGCTCTGG
TTGGACAGCAGCTCGAGGCTGTGACTTGGTCAGAGGCTTG
ATGCAGTGTGTTTTGCTGACAGAAATACGACTGGAGTCTG
TGGTACTCGACCAGGAGGGTATAAATATCCTAGCTCAAGG
CTTGAGTCGACTGGCCTCACTTCGGAGGCTCAGCTTAAAC
AACATTACAGTGGTGACATCTGAGACTTTTGTAAATGGCA
CTGGAATACTCTGTCTACTGGCCTCTTTTAAAGGTTTCAA
ACAGATGGAGGAGATTGAGTTGGAAAGTTGGCGGATGGGA
GATGGTGGTACCAATGAGCTTGTGAAATACATACCTTCAT
GGACAGGGCTGGTAAAAATAAGTCTGTCAGAAAACATTGT
GACTGACCAGGCCGGAGAGAAACTCCTCACAGCACTTTCC
CATTGCAGAGCTCTTCAGCAGCTCAAGTTGTCTAAAAACA
AGCTTGGTCAGGCCAGTGCTGCCAAGCTTGCTAAAATTCT
TCCATTGCTACCTCAGCTTTCAGAACTCAATTTATCAGAG
AATCAGTTTGGCCCACAAGGATCAAGTGTTCTTTGTGAAG
GTTTGGTGAGCATGAAGGCACTGAAAAAACTACATTTGAC
TTCGGTTGAGTCTTCAGATCTGGTTGGTGTGGCTTCATCC
TTAAAACACTGTCCATCCATAGAGGATGTCAGTTTGTCAT
GGAATGGATGTGGTGACAGTCTTGCACGGACACTGGCTGA
GATTCTTCCCTTGTGTACGAAGCTGAAAAGACTCGACCTG
GAGGCTAATAACATAACCACAGCGGGAGCCACACTGATTG
CCAAATGCCTCCCATTATGCCCATCCATTGAAGTTATAAG
ACTCTGGAGGAACTCAATTGCCAAAGATGATGAAAATCTG
AAAGATCCCAAACTCAACTTTTCATCGGTTTAATCCCTTT
CTTTCTTTTTTCTATTTTGGATTTAGTTTTTTTGTGTTTT
ACTTTTTTATATTATAAATACTACTAGTTCTGTGCTCTTT
GCATTTTTAGTTCAGTGCTATTTGCACTATTTATACAGGG
AACACATTACCTCATTTGAGCAATTCATTACACCAAACGA
TACAGTTTCCAGCAGTTCAGGGATGGAAAATCTTTTAATG
TCCATGTAATAGAAACAATATTCTCTAGTCAGTAAAAAGA
AAGAGCATGTGAAATAGCTCAAGAGCATTTTAAGAGCATA
AAAATATTTCTAAGCCAGATGGCACATTGAGGCAGGCAGC
TCTCTTGACACACACATGCTCTTTCTTTTCTGATCCACTG
ACATCTATTATAGGCATTTATGCACTGATCCACCTTGGAC
ATCACACTGTTGTGTTCCCTTTTGAATTACGTATTTATAT
CTGCATTTGACTTGATCTGCTCAGCTTTCATCTACAGAAC
TAATTTTGTTATTTGCGATATGCTTCATTCTGTTGTAACT
GTAAGTGAAACTGCACAGTGCTTGAATTACTGATACACAA
AACCACTTTCTTTGTCACAGTAGTTGCACTGATCAGTTTG
CATTTATTATGCCTATTCATGCCTTTTTTGTGTACTTTAA
TAAAGGTGATTAATCACTTCTTTTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nlrc5-202 Contained in:
OTHER nlrc5-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055975 (1)
  • Ensembl_Trans:ENSDART00000151865 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT057642 (1) 757bp
    GenBank:EB845889 (1) 470bp
    CITATIONS (2)