header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120702-68
Transcript Name: si:dkey-192l18.10-001
Previous Name: dkey-192l18.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055968 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055968|OTTDARG00000039036|ZDB-GENE-120709-107 si:dkey-192l18.10|no_translation DKEY-192L18.10-001 LG_ BX005461.9 Danio rerio lincRNA NOVEL, 1286 bp
GAAGGACTGCACATGCTGGTGAACTTGACCAGAATGCATG
CACATTCAGGCGCTTCTCCTTTAGGGGTGAAAGTGGACCA
GAGATGTGTAATATGCATGTTCTCCAGTTTCCATGTTGCT
GGTAAGCTCAAGGAGATGATTTTTGCAAAGCTGTGATTTA
GTAAAGAAGTAAAAACCCTTGACGCTTATTTAACCATTAA
GGCAACTTCATTAGATCAACTTCACCATTCCTCAACACAA
CACTGAGGTGGACAAGTCTCTAGAACTGCTGGCATGGACA
TTGGTGAAGTCACCAGGCCAACAGTGGAAGCCAATACATT
TGTGTCCTTGGTTGACCATCACGAAATGGAGCAAGAACTG
AGACATGACTTGACCTGTAGCTCTTTCGACATATTGTTCT
CAGTTACATTTAATAAAAGAACACCTCATTGATTATGCCA
TCTACTTCAGTGCACTGGGGGATGTTGACTGATACAGATT
GGACCTCGCTTCAACACCCCTCCACCAATCTGATTTGATG
CGACTGCTGGTTCTGCATTACTTGTGTGGGCAATCCATCC
ACAAAGGATGATCACAATTGTTTGACTTATTTCAATTGCT
GTAATGCAGAAGTGTCCAAGCTCTATCCTGGAGGGTCGGT
GTCCTGCAGAATTTAGCTCTAACCCTATTCAAACACCTGA
ACCAGCTAATTGGTATCTTACTAGATATTTCCTAGCAGGT
GTTGGAGCTAAACTCAGCAGGACTCCTGTACTGAGGACAC
CTATGCTGTAATGAGTCTCAACTCCATTCCTGGAGGGCTG
CTATGTTGCACAGTTTTGCTCCAACGCTGATCTCATTACA
CCTTGATGTGTTTGATTTAAAGTTGGAGCAAAACTGTGCA
GTGCTGCAGCCCTCCAGGAATGGAGTTTGAGATTTGTGCT
GTAATAAAGCATCTTGTATGGGTTTTTTTTTCTCAACTGT
TTTCAAACTAAATATCCAATCTTAAATTTCACATGTTAAA
GTTAAACAAAATCAATACTGAACATTATAAAACAATTTTT
TTTTTTTTAAAATACAATTGACTAAAGGTGATTAAATTAC
ATTTAAATTACATTACACTTCTAATTACAACAGTAAAGAA
ATAAATTTTAACTCTGCATTTAAAAATACTTTTAACAAAT
CTATTTAGAACTTAGTATTTATAACTTTTCTTTTAAACTT
TTAAACTGAAAATAACTTTTCCCCTCTCTAATAAACCAGA
AATTTCTACAAGCGATATGAATCAATATGTCTGCTATTAA
ACTGCA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-192l18.10-001 Contained in:
OTHER si:dkey-192l18.10-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055968 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH537038 (1) 1015bp
    GenBank:EH558282 (1) 788bp
    GenBank:CO926432 (1) 690bp
    GenBank:CN016671 (1) 686bp
    CITATIONS (1)