header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120702-122
Transcript Name: cadps2-205
Previous Names: cadps2-002, ch211-245m13.2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056643 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056643|OTTDARG00000022438|ZDB-GENE-030903-1 cadps2|OTTDARP00000044428 CH211-245M13.2-002 LG_none BX322610.5,AL929183.14,CU234174.9,CR752641.12 Danio rerio protein_coding KNOWN, 1811 bp
GGGGACCTCCCACGTGTTGCATGTTGTCTATGCCACAGGT
TGCCTACCTGTCTCGCATTACTCTGCACTAACCTCCACAT
GCCAGCGCTCTTTTCTCTACAAAGAGAAAAGAGAATGTGG
CTCAAATCCCTCGTTACGGAATCGTTCTCGGATTGACTCC
GCCCTCAAAAGTGTCGCGACTGACACATTTGACATTCTCT
CAGCAAAAAAAAAGCTTTTGTGGTCGAGGTCCTCAGAAAC
CTCACGGGTTTCCTGGCTTTCTCCACAGCTGTGAGGAGTT
GTCGCCTCTTTAGTGTCGATTATGCTGGACCCGTCCTCCA
GCGAGGAATCTGAGGGGGAACTGCCACCTGAGGACGACCC
ACCCGTTAAAACTGGGAAACCTGTAAAAAAAAGTCCCAAA
CCTGAAAAGACTTCGGATGCCTCGCGAACCCAAACCAAGG
AATCAGTTCCTTCTCCTGCTGAGGCGGACAAAACCGAGCA
GGAGAGACTTAAAACGGAGGAAGCGGAGAGGAAAATTAAA
CTACAGATTTATGTGTTTGTGCTGAGATGTATCGCGTATC
CGTTTAACGCTAAACAGCCCACAGATATGGCTCGACGTCA
ACAGAAGCTGAACAAGCAACAGCTGCAGGTGGTGAAGGAG
CGCTTCCAGGCCTTCCTGAAAGGAGAGACTCAGATTGTCG
CTGATGAGGCTTTCTGCAACGCTGTGCGCAGTTACTATGA
GGGCTTTCTGAAGAGTGAGCGAGTTGCCCGCATGGTACTG
AGCGGAGGTTGTTCTGCCAGTGACTTCCGTGAGGTCTTCA
AAAAGAACATTGAGCGCCGCGTGCGCAGCCTGCCTGAGAT
TGACGGCTTGAGCAAAGAGACTGTCTTGAGCTCCTGGATC
ACCAAGTACGATGCCATCTACAAAGGAGAGGAGGACCAGC
GGCGGGCGCAGGGAAGAATGCCGTTCAGCGCTGTCTCAGA
GCTCATACTTAGCAAGGAGCAGCTTTATGAGATGTTCCAG
CACATCCTGGGAATCAAAAAGTTTGAGCATCAGCTACTCT
ACAATGCCCTTCAGCTGGACAATGTGGACGAGCAGGCAGC
GCAAATCCGCAGAGAGCTGGACGGGCGACTGCAGCTGGCT
GAGAAAATAGCCAGAGAGAGGAAGTTTCCAAAGTTTATTT
CCAAAGACATGGAGATGATGTATGTGGAGGAGCTCAGGTC
ATCCGTTAACCTGCTAATGGCTAATCTGGAGAGCCAGCCT
GTGGCCAAAGACTTCAAGCCCAAAGTCAAGCCCAAACTCA
CACCCATGAACAGCTTCCTGGACATCGGTGATGAGAACGA
CTTGCCCCTCTCCAAGTCTGACGTAGTGCTGTCGTTTTCC
TTAGAGATTGTGATCATAGAGGTTCAGGGGCTGAAATCCG
TTGCTCCTAACCGAATTGTGTACTGCACCATGGAGGTGGA
GGGAGGTGAAAAGCTCCAGACGGATCAAGCCGAAGCCTCC
AGGCCACAGTGGGGCACACAAGGAGATTTCACCAGCACAC
ACCCCCTGCCAGCGGTCAAAGTCAAACTATTCACCGAAAG
CACCGGAGTCTTGGCACTGGAGGACAAAGAGCTGGGCAGG
GTGGTTCTTCACCCCACAACAAATGGGCCCAAAACGGCAG
AGTTGCACAAAATGGTGGTGCCCAAGAACAGCCAAGACGT
GGATCTTAAAATCAAACTGGCGGTCCGCATGGACAAGCCC
CCCAACATGAAGCATAGCGGGTATGTCTTTTGATGATGCT
CATATTCTGACCACTGGCATCTAAAGCTATTTTGTATCTA
TATTATTTAAC

cadps2 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript cadps2-203 (1)    Ensembl 539
mRNA cadps2-201 (1)    Ensembl 1618
cadps2-202 (1)    Ensembl 2572
cadps2-204 (1)    Ensembl 769
cadps2-205 1811
ncRNA cadps2-006 (1)    Ensembl 758
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cadps2-205 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056643 (1),  Ensembl_Trans:ENSDART00000151994 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AW153581 (1) 721 bp
CITATIONS (2)