header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-952
Transcript Name: rcn3-201
Previous Name: rcn3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053535 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053535|OTTDARG00000037487|ZDB-GENE-040625-175 rcn3|OTTDARP00000042107 rcn3-001 LG_ FP236454.4 Danio rerio protein_coding KNOWN, 1587 bp
ACGTGCACTTTTAAAGAACAGTGCCAACGCGTACTCTTCA
AGTTAAGATTGAGTGTACTCAAGCTGAAATCACTGCTGGC
TTGTGAGAATATGCAGCTGCTCTTTCTGGGGACACTTGCC
CTGTTTGCTGGGCTCTCGGTTGCGGTGCCAGCACAGGAGA
AGCGTATACATCATAAGCTAGACCTCAGTGACCATCCTCA
CGATGATGCCCACGGTTTCCAGTTTGACCACGAGGCCTTC
CTGGGGAAAGAGGAATCCAAGACCTTTGACCAGCTGAGCC
CTGAGGAGAGCAAAGACAGATTAGGAAAGATTGTGGATAA
GATTGACACAGATAAGGATGGCTTCGTCAGTCATGCTGAG
TTACACCACTGGATCAAGCACAGGCAGAGGAGGTACATCG
AGGAGAACGTGGACAAGCACTGGAATGAGTACGACCAGAA
TAAGGATGGGAAGATCGGATGGATTGAGTACAAGAACACC
ACCTATGGATATTATATAGACACAGAGTTTGATGATGTGG
ATGATAAAGCCACCTACAAATCCATGCTTAATAGAGATGA
GAGGCGGTTTAAGTCTGCAGACAGGGATGGGGATGGTGTC
GCCACCAGAGAAGAGTTCACTGCCTTCCTCCATCCAGAAG
AGTTTGACTTTATGAGAGACATTGTGATTCAGGAAACAAT
TGAAGACATTGACAAGAATGGGGACGGCAAGATTGATCTG
CAGGAATACATTGGGGACATGTACAATCCTGAAGATGGAG
AGACTGAACCAGACTGGGTCACAACAGAAAAGAAACAATT
TTCAGAGTTCAGAGACATGAACAAGGATGGTTTCCTTGAT
GCCACTGAAGTATCGCACTGGATCCTCCCGACAGAAGTTG
ACCATGCTGATAATGAAGCCCGGCATCTCATTCATGAAAC
CGATAAAGACAACGATGACAAAATCACAAAGAAGGAGATT
CTGGAAAACTGGAACATGTTTGTTGGGAGCCAAGCGACTA
ATTACGGAGAGGATCTCACCAAAAGACACGATGAGCTTTA
ATGTTGGCATATCTGGGTAGAGGGGAGGACAGTATATTTT
GGGCGTAGGTCAGAGGATAGAAAATTGAATAAGAAAATGA
CAGACAATCTTCGTTACCTGCTGTTTTGAAACATTTCCAG
GGTCCTCAGTCAAGGGTTAGACTTTTCGGTCAATGAAGAT
AAGAATCTAACTGAGACAGATACAAGTTTTATTTATTGTC
ATTTAGATAAAAAGGTGATTACACATGGGACCTTTTGAGC
AATGCTTCTGAGCAACATTGAAGATTACTTTTCTATTGAA
AATGGGAAACAAAACAATATCTGAAATGGATTCTGTTGCT
GGGTCTCACCTGGTTTCCCATTGGTGGCATCATTATCCGT
ACCATTGCTTTAAAACTTGTCCTTTGTATCATGACATAAA
CACTCGCATTCCTTATAAAAAGACACTCCAGCTTGCTTAT
ACTGCTTGAGCAAACAATATTACGTCTTCCACTTCTCAGG
AATTCAGCACTGAATACAGGTCCAGCTTCGTTTGTATTCA
ATTAGGGAGATTTTGACTGTTACAAAA

rcn3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rcn3-201 1587
rcn3-202 (1)    Ensembl 1454
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rcn3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000053535 (1),  Ensembl_Trans:ENSDART00000055324 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC071338 (1) 1577 bp
GenBank:EB864147 (1) 381 bp
GenBank:EB836842 (1) 291 bp
CITATIONS (2)