header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-566
Transcript Name: rcn3-202
Previous Name: rcn3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053534 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053534|OTTDARG00000037487|ZDB-GENE-040625-175 rcn3|OTTDARP00000042106 rcn3-002 LG_ FP236454.4 Danio rerio protein_coding KNOWN, 1454 bp
AAGTTAAGATTGAGTGTACTCAAGCTGAAATCACTGCTGG
CTTGTGAGAATATGCAGCTGCTCTTTCTGGGGACACTTGC
CCTGTTTGCTGGGCTCTCGGTTGCGGTGCCAGCACAGGAG
AAGCGTATACATCATAAGCTAGACCTCAGTGACCATCCTC
ACGATGATGCCCACGGTTTCCAGTTTGACCACGAGGCCTT
CCTGGGGAAAGAGGAATCCAAGACCTTTGACCAGCTGAGC
CCTGAGGAGAGCAAAGACAGATTAGGAAAGATTGTGGATA
AGATTGACACAGATAAGGATGGCTTCGTCAGTCATGCTGA
GTTACACCACTGGATCAAGCACAGGCAGAGGAGGTACATC
GAGGAGAACGTGGACAAGCACTGGAATGAGTACGACCAGA
ATAAGGATGGGAAGATCGGATGGATTGAGTACAAGAACAC
CACCTATGGATATTATATAGACACAGAGTTTGATGATGTG
GATGATAAAGCCACCTACAAATCCATGCTTAATAGAGATG
AGAGGCGGTTTAAGTCTGCAGACAGGGATGGGGATGGTGT
CGCCACCAGAGAAGAGTTCACTGCCTTCCTCCATCCAGAA
GAGTTTGACTTTATGAGAGACATTGTGATTCAGGAAACAA
TTGAAGACATTGACAAGAATGGGGACGGCAAGATTGATCT
GCAGGAATACATTGGGGACATGTACAATCCTGAAGATGGA
GAGACTGAACCAGACTGGGTCACAACAGAAAAGAAACAAT
TTTCAGAGTTCAGAGACATGAACAAGGATGGTTTCCTTGA
TGCCACTGAAGTATCGCACTGGATCCTCCCGACAGAAGTT
GACCATGCTGATAATGAAGCCCGGCATCTCATTCATGAAA
CCGATAAAGACAACGATGGTCGTCTTTCTATCAATGAGAT
CATGGATAAACTGGATTTCATTAAAGTCAGCACTATTACT
GACTATGGGACCCTGATAGAAGTTCATGATGAACTTTAAC
CCTATTATTAACACAGAAACATGAATGTATCTTTAAACTA
ATAAAATAAGACAAGTGTCACTTTTAAAGTGTGTAAAATG
AAAGATTTATTGAACAAAAAAAAATCAACTACATAATGTG
TACATATGACATGATAACTTCTTTACAGGCATGGAAAAAA
ATACCATTCAAAAATGATCCCTTATTAAAGAAATAACAAC
AAATGACCTAAAATAAATCCAGGAGAATGAATGAATGATA
ATATTTACAGCATCACAGCGTTGTCCAATCCTCACATTTA
TGCTTGCATTACGGGTCTGGCCTCTTTAGCTTTGAGGTCC
ACTCCTGAGCCCGCGAAGCCAGTCCCACCCTGCCGAAGAA
CAAATGCAGTGCTGTTAGTGAGTTTACACTCAGAAAATAT
ATATTTTTACACAGCTTGTCAAGACATATATAAATAAATA
CATATTTAAAAAGT

rcn3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rcn3-201 (1)    Ensembl 1587
rcn3-202 1454
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rcn3-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000053534 (1),  Ensembl_Trans:ENSDART00000151476 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH487388 (1) 1005 bp
GenBank:EH520790 (1) 900 bp
GenBank:EH513780 (1) 827 bp
CITATIONS (2)