ZFIN ID: ZDB-TSCRIPT-120213-536
Transcript Name: rbfox1-004
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053433 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053433|OTTDARG00000021708|ZDB-GENE-040927-11 rbfox1|OTTDARP00000042036 rbfox1-004 LG_none CR388084.7,BX545915.7,CT990570.4,CR381596.11,CR792426.18 Danio rerio protein_coding KNOWN, 774 bp
CCGCTGCAACTTAACTACGTCCAGTCACCAACTCTCCTTC
CTCTTGCCTGTGATTGAGCGTATTTACAAGAGCGACAAAC
GGACTGACTAGTGTTTCGTGTGTATTTACAAAGGCTTTAC
CAAATCCGTGCAGGACAAGAACAGACTCGCGCTGTGTTTT
TTGCTCATCACCGGGACCCTCGCGCTCTCACATCCGCCGG
TTATTCAGCCACGTTTGCGCACACTCCGTGGCTGCTTCCA
GGCTTTGTAACCGCATCCTATCCTGCCAAAGCAGACTCTG
AAACTCGGTGGAGAGAACAGGACGAGCGGACGCGAACACG
ATGCAGCATCCCTTGACGGGCGGAACGTGCGTCGCCCTGC
CGAACGTGGACATGTGTCCGCAGCTCTCCTGTGCCTTGAC
TTTCATGTACTTACAGCAGGGTAATCAAGACGCCCCAGCA
CCCCCAGAAACCATGGCCCAGCCTTTCCCATCGGCCCAGT
TCGCTCCCCCTCAGAACGGCATTCCTGCTGAGTACACGCC
GTCCCACCCTCACCCGACCCCAGACTACTCGGGCCAGACC
CCGGTGGCAGAGCACACGCTGAACTTGTACACCCCTGCCC
AAACGCACAGTGAGCCCAGCGGACCAGACAACAGCATACA
GGCGGTCTCCGGCACAGCCACAACAGACGATTCAGCACAG
ACAGACAGCCAACAGCAAACACAGTCATCCGAAATCACAG
AAATCAAAACGCAGCCCAAGAGGCTCCACGTCTCCAACAT
CCCCTTCAGGTTCA

rbfox1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rbfox1-001 (1) 3190
ncRNA rbfox1-002 (1) 662
mRNA rbfox1-003 (1) 759
rbfox1-004 774
rbfox1-005 (1) 944
rbfox1-006 (1) 865
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbfox1-004 Contained in:
OTHER rbfox1-004 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053433 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT870987 (1) 790bp
    CITATIONS (1)