header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-405
Transcript Name: atp11b-201
Previous Names: ch73-163i13.1-001, si:dkey-211e20.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052758 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052758|OTTDARG00000037026|ZDB-GENE-081031-13 si:dkey-211e20.10|OTTDARP00000041469 CH73-163I13.1-001 LG_none BX005105.6,FQ790212.2 Danio rerio protein_coding PUTATIVE, 3141 bp
CGCAAACCGCAGAAGAATGAGTGTGATCCTGCAGACACCT
TCAGGCAAAAGGTGCTGTTCACTAAAGGAGCCGAATCCGC
CATCCTGCCCTACACCAAGAGCGGTGAGATCGACAAAACC
AGAGTCCACGTGGACGAGTTCGCTCTGAAGGGTTTGAGGA
CACTGGTGGTGGCCTGCAGGCACTTCAGTGCGGACGAGTA
CAGAGATGTGGACCGGCGGCTCCATGAGGCCCGGACGGCT
CTTCAGCAGCGAGAGGAGAGACTGGTGGAGGTCTTCAACT
TCATCGAAAGAGACCTGGAGCTGCTGGGGGCCACTGGGGT
GGAGGACAAGCTTCAGGATAAGGTCCAGGAGACAATTGAA
GCTCTGCGATTGGCTGGAATCAAAGTGTGGGTGTTGACAG
GAGACAAGCACGAGACGGCGGTCAGCGTGAGCCTCTCCTG
TGGTCATTTCCATCGCACCATGAACATCCTGGAGCTCGTG
CAGCAGAAATCAGACAACGAGTGCGCAGAGCAGCTCCGCA
GGCTGGCCCGGAGGATTAAAGAGGATCATGTGATCCAGCA
TGGGCTGGTGGTGGACGGGGCCAGTCTGTCTCTGGCTCTG
CGGGAGCATGAGAAACTCTTCATGGAGGTGTGTAAGAACT
GCTCGGCGGTGCTCTGCTGCAGGATGGCACCTCTCCAGAA
AGCCAAGGTGGTGCGACTGTTGAAAACATCCCCAGAGAAG
CCCATCACATTAGCCATTGGTGACGGAGCCAATGACGTCA
GCATGATCCAAGAGGCTCACGTTGGTATTGGAATCATGGG
AAAAGAAGGAAGGCAAGCCGTGCGAAACAGCGACTATGCA
ATCGCGAGGTTTAAATTCCTCGCCAAATTGCTGCTTGTGC
ACGGCCATTTCTACTACATTAGAATAGCAACCCTCGTGCA
ATACTTTTTCTACAAGAATGTGTGCTTTATCACTCCCCAG
TTTTTATACCAGTTCTTCTGTCTGTTCTCTCAGCAAACTC
TCTATGACAGCGTGTATCTGACGCTGTATAATATCTGCTT
CACCTCTCTGCCCATACTGGTGTACAGTCTGTTTGAGCAG
CTGGTGCATCCTCACGTTCTGCAGAGCAAACCAGCACTTT
ACAGAGACATCAGTAAAAATTCCCTGCTCTCCTTCAAAAC
CTTTTTGTATTGGACCGTCCTGGGCTTCTGCCATGCCTTC
GTCTTCTTCTTCGGGTCCTACATCCTGATGGGAGAAGACA
CCACGCTGATGGGAAACGGACAGATGTTTGGAAACTGGAC
GTTTGGCACTTTAGTATTCACTGTGATGGTTATTACGGTA
ACACTGAAGCTGGCCTTAGAGACACACTTCTGGACGTGGA
TGAATCACTTCGTCACGTGGGGCTCCATCGCCTTCTACTT
CATCTTCTCCCTGTTTTACGGCGGCATCATCTGGCCGTTC
CTTCACACGCAGGACATGTACTTCGTCTTCGTCCAGCTTC
TGTCCAGCGGCTCGGCCTGGTTCGCCATCATCATCATCAT
CATCACCTGTCTGTTTCCTGACGTCATCAAGAAGGTGTTT
TACCGGCACCTGCACCCCACCAGCACGCAGAAATCTCAGT
TTATTGAGGCCTACCAGGGCATCGGATGCGTGGACTCCAT
GTGCTGTTTCTCAGAGGGGCAAAACGCCTGCTCACGGCTG
GGCCGGCTGGTGGAGCGACTGATGGGCCGCTGCGACCCAG
CCCGGACCCCCAGATCTTGGCACGACTCCGACACCTTCTT
CTCCAACGACCGGAGCATCCTGACGCTCTCGCCCATGGAG
GTCTCTCATTGTTAAAGCACCAGCCCAAAAAAACAAAAAA
AGGGACCGAGTTTGAAGACGCCTGCCCCTTTACCTCCCTC
CCCCCACTTGTCCAATCACCAGCCAGACTTTCTCTGATGT
CACACTTATCAAGCTCTGTTAATCAGAGCATATAATCAGC
AACGAGGAATACGCAGTGGTCCCCCCCAACAAATAACCAA
AGGATTGGACTCTTGAACGCTTCTGTGTTTTCGGCTGCTC
ATAAAAACCTTGAAACTGTACACAAATGGCCGCCGTCTTT
CCTGAGGAAAAATGAAGGAGGTCTGTTTTTGAAGCCATAT
AATTCCCTCCTTTAATTGCCTGATTTTCAAGGTGTATTAA
ACATGTGTAGCGCCAGCTCACCAAACCTGTAGCCTCCTAC
CCTAAGATGCCTACCTGTACACCCGGGTTGTACAGACTTT
ACCACGATGCAAGAATGTCGAGGAGGGAAACTCAAGCATA
TCATCCTTTAAGCCTCCATCAGTCATGTGCCTGCATATTA
TGTCTCGTTTTCCACTGTTGCATGTTTTATTTTCGGCATT
TCTGTCCACAAAACATTGCTGTGTTTATTTTTTTTTCTGC
TTGTGTTGCTAACCACTTGTCAAGCGCTGTTTGTTTGTCT
GTGTGTGTGTGTGTTATTTAATCTCGTGAGAGGGCATAGT
CTTGAACTGAATAATACTCGTCCTAAAATAAGGCCCGGAG
CATTGAGACAACCGTTTTAAACTTGCTTAGATCAACTATA
TTGAAGTTTATGATATCAAGACTGCATGCTACACATGTCT
CAATAATCCTATAAACAGAGGCCTGAGGAAACTGGACCTA
AATGCTCCCATTTTGAGGAGTCTCATCTTTTTTGGGGGCG
GATTTCTCTTTATTTTTGTGCTGCAAGACTGAGGATTTCG
GGTGAAATCTGGTGCCGTGACCCGGATGGGAGTTGGGAAT
CTGCATTTATGTTGGAGTATGGTTACATTTAGATTATTTT
CTATCTTCTTCTCTTCAGTTTTATTCGTATATCACTTTTC
ATGTCAATGTTCAAACCCCAAACGACTCCCGACCGCTGAT
CATAACTCTGTTTGGCTATATAATGTGTTGAATTATATAG
CGACGCCACTTATTACTCAGAGACATTAGCAATAAGACTC
AATCTAGACTGGAAATACCTGATCTAGCCGTGATGTCAGT
CATCCATAATGCGGTTGCATCTTTATTTTCGTGTGTGTAC
GTATTCATGCGTTCTTCTTCTTGTACTCTCCTTAATGGTG
AACATGTTTAATTGCTGATGTTTATGAAAGTTCTATTTAC
AGAATAAATACATTTATAAAA

si:dkey-211e20.10 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA atp11b-201 3141
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atp11b-201 Contained in:
OTHER atp11b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000052758 (1)
  • Ensembl_Trans:ENSDART00000165923 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC078403 (1) 1695bp
    GenBank:EH997792 (1) 974bp
    GenBank:EB931326 (1) 671bp
    GenBank:EB910361 (1) 649bp
    GenBank:FP160618 (1) 603bp
    GenBank:AL919635 (1) 539bp
    GenBank:FP208303 (1) 408bp
    CITATIONS (2)