header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-338
Transcript Name: si:dkey-150k17.3-001
Previous Name: dkey-150k17.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054529 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054529|OTTDARG00000038075|ZDB-GENE-120215-144 si:dkey-150k17.3|no_translation DKEY-150K17.3-001 LG_ BX957317.12 Danio rerio lincRNA NOVEL, 1907 bp
GTTTTGCGCTTATGGATTATAACGACAAAACGGGATTGCC
TCTCAGTGGACCTCCACACGTGTTTGACAAAACTCTCCGA
AGATGACATCCTGACGTAGGTTCTTGTGTGGGAGCTGAGG
TCTTTTCCCAGACACAACAGAAGCCAGAGCCTGTGGTTGA
TTTCATGACTTCCTCCTCATTGTTTGCCTGTCTGCGTGAC
TGGAAACCGGCAGTGACAGACCGATGACTCCGGCCTCTCT
TTAACCAGGCTTGTGGAGAAACTGGACCTGGCTCCCTCTG
AAGTATTGGAGTTCAGCAGCAAAGAGCATCAGGAAGCATT
ACCACATCACTCACAGTTCAGCTCTCCGGCAATGCCCTGA
CCTCCTGAACCCTGACCTTAAATGACCTCTCTTCGTACTC
TCGGTTTAACTAGCTCAGCGGCTCTCAGTATCAGCCTTCA
GCGTGGGAACCGCACATAACTGATGGCCGAGTGTGGAGGA
TAGTCGTGTTCTGGTTCTGAATGATACCTCTGGGCTAAAG
CGGGAAAGCGTGGACATATCTCTCCATCTGCTTCCCTGTG
ACATCAAAGGAAAAGCCTTGGATTCTACGGCCTATATATA
AAACCTGCAGGAAGACATGTGTTATTCTGGCTCTCTTCCT
GTAACCTAAGGCTGATCTCGAACACTCTTTTTCTCATTCT
CTCTCACTTTGTCTGCTTTGTGCTGAAGTGGACACTCTTA
TGACTAAGTGTTGTCATTTTATGTGCTTCTTTCATGTTAT
ACAGTCTTCTTAAAGTGATAGTTCACCCAAAAATTCTTTC
TTCATTTACTCATCTTCTACTTCTGCTCAACCGGTTTGAG
TTTCTTTCTTCTGTCAAATGCCAATAATGAAGATATTAAA
GAATGCTGGTAAGAAGCAGCCACTGACATTTTGGTTTCTA
CTGTGAATGTCAGTGCTGCTGGTTTGCAATATTGTTCAGA
GTATGTACAGTACTAAATAGTAAGGGAGTTTTTTATTTTA
GGATGAACTTCTGGATTAACCTTTTATTTTTGGATCTTGG
GGTTAAAAGTACAGCTACCTAAAAAGGAAAATCCTGTTGT
TGTTTTTTTTCACCCACATGCCATAAACAGAAAAATACAC
ACAGAGAAAATTACATTTGCTGCTTATTTTAATTACAGTT
TGAAAATGTTCAGTATTTTTGTTCATTATTGTTCAGTCGG
CTTAAATGTGTATAAAAAAAGTCTGTAAGAGCCATAGTTT
GATTTAATACAACTTATTATTAGTGCTCTTATTCATGTAC
AGTTTACACTTGTTTACATGTTTACTTGTGTGAATTTGTT
GATTTCTCCCTATTCTTTTGGTTGAAACGGTTTGCTGTAT
TATGTATTATTATTAAGTTTTATTATGATATAGAAAAATG
AAAGAAACAAGACCGGAGTTTATTGTCATGCTGTTTGAAA
ATTCAGTAAACATCTTTAAATGGAAAGAAACCCAATTCAA
TTTATTGTCGGACTGATTTTGAAATTTTGAGTTTAAATAG
TCCTTATTTTATGTTATTTATTAAATTATTTTTGTTGATA
TTACTAACTGAGTAGTAAATTTATAATTTCCTTCCCAGCA
TAATTTTTACTAAGTAAAGGGTTAGACCTATTTAATCTCC
ATTTATTTTAAATATATGGAAGAGTTTCAATTGAAGTTTT
GAGTTCGGAGGTTATTCCTATGCAATAATTATTGTTTCTT
CACTCAACAATTCATTTGTTATTACCAGTTTGAGATCAGT
CTCTTTTTACTTGTTCAATCCATATGTTATATATGGAACA
AAATAATAATTTTAAACTGTAATTTTGTTTGTCGAAATTA
GATGATTAAGATGACTAAATTTGCTAAATAATTCAAATAA
AAGTGATGAAATCTTGTTGGTTCAGAA

si:dkey-150k17.3 TRANSCRIPTS
Type Name Length (nt) Analysis
lincRNA si:dkey-150k17.3-001 1907
si:dkey-150k17.3-002 (1) 620
si:dkey-150k17.3-003 (1) 1987
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-150k17.3-001 Contained in:

Genome Resources: Vega_Trans:OTTDART00000054529 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DT877156 (1) 797 bp
CITATIONS (1)