ZFIN ID: ZDB-TSCRIPT-120213-1158
Transcript Name: zgc:77517-202
Previous Names: dkey-195m11.4-002, zgc:77517-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055084 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055084|OTTDARG00000022018|ZDB-GENE-040426-1508 zgc:77517|OTTDARP00000043201 DKEY-195M11.4-002 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 1302 bp
CGCACACTCATCTTCTACTGCAGCCAGAGCTTCATTCCTC
CAAAACCATGAGCTTCTACGCACCCCAGGCCTCTCACATC
TCCTTCACCCGCTCTGCGCCCGCTTACCGGGCTGCCAGTA
CGTATGGTGGGGCAGGTGGGCAAGGCACCAGAATCTCATC
CGCTTCTGCGATGTCTTATCGTTCAGCCCCTAGAAGTGGG
GGAATTTCCTCTTCCACAGCCTTCAAGGTGAGCTCAGCCG
GCATGGGCTCTGGCGCAGGGGGTTCCTTCTTGGCGAGCTC
TGGGTCCTCAGGTGGCATGCTGGGCAATGAGAAAGGCCAG
ATGCAGAATTTAAACGACCGTCTGGCTGCTTACCTGGACA
CAGTGCGCAGGTTGGAGCAGGAGAACGGCAAACTGGAACA
GCAGATTCGAGAGGCTCTGGAGAAAGGTGGACCAGAAACA
CGCGACTACAGCAAGTACAACGCCATCCTGGATGACCTGA
GGAGGAAGGTGTTTGATGCCACTGTGGACAATGCTCGTCT
TGTTCTGCAGATTGACAACGCTCGTCTGGCTGTGGATGAC
TTCAGAGTCAAGTTTGAGAATGAGATGGCAATCAGGCAGT
CTGTGGAAGGAGACATCGCAGGTCTAAAGAAAGTTATAGA
TGAAACCAATATTGGTCGCCTGAATGTGGAGGGAGAAATC
GAGTCCTTGAAAGAAGAGCTTGTCTTCCTCAAGAAAAACC
ATGAAAATGAAGTTGATGAGCTACGGAGCCAGATCTCTCA
GTCAGGCGTTCAGGTGGATGTTGATGCACCCAAGGGCCAG
GATATGTCTCAAGTGATGGAAGACATGAGAGCTAACTATG
AGAAACAGGCTCTCAAAAATGCAGAGGAACTCAAAATGTG
GCATGAAACCCAGATAGCAGATGTTCAGGTGCAGGTGGCT
CAGAACACAGAGGCATTACAAGGTGCTCAGATGGAGTGTA
ATGACCTACGCCGACAGATTCAAACACTAGAAATAGAGCT
TGCATCACAACAAAACCTGAAAGCGTCACTTGAAGATACT
CTACGAAACACTGAGATACGTTCAAATGGAGAGATGGAGA
AGTTAAATAACATCATAATTCAACTTGAAGCTGAGCTGGC
ACAGCTGAGGGCAAATATCACAGAACAGGGACAGGAATAT
GAAGCACTCCTTAATATGAAGATGAAACTGGAAGCGGAAA
TTAACACCTACAAGAAACTTCTAGATGGGGAAGATTTCAA
GTAAAGAGGAAAAGTTTAATTCTTGTATTTCATAGGGCAT
TAAATACAGTCACTGATTCTAA

krt18b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA zgc:77517-201 (1) 1827
zgc:77517-202 1302
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:77517-202 Contained in:
OTHER zgc:77517-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055084 (1)
  • Ensembl_Trans:ENSDART00000151322 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC153603 (1) 1328bp
    CITATIONS (2)