ZFIN ID: ZDB-TSCRIPT-120213-1110
Transcript Name: gmnn-204
Previous Name: gmnn-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054534 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054534|OTTDARG00000017117|ZDB-GENE-030429-30 gmnn|OTTDARP00000042836 gmnn-003 LG_ BX957279.13 Danio rerio protein_coding KNOWN, 808 bp
TTCAGAATGGTAAAGCAGTGGCCAAAAGGAAGATGTGGAG
CGCCGAGCAAGTGAAGGGTTCAAAGAGAGTCAAAGCAGAG
GTGGCTGTCAAATCCACAAATGCAGAAAATGAAAACCAGC
CTGAGGGGGTCACACAAGAGGCCTATGAGCTCATGATCAA
AGCATCTTCCTCTGCCTATTGGGTACTACTGCATGCAGGT
GCCTTTGATGGCGCAGAATGTTTAGTCAACATTGTGGGAA
GATAACTAGCAAACATGCAGTACAGCACTTCAGAGTCACA
GCTAGCGATCAGATTTTCAATATGGCAAGCTGAACGCATA
CTGTACAGGCGACGCAACGCGGAGGAGATTGATTGACAAT
GGTCTGCAGCCAGTCAGGACGCAGAACAATGCGTTGTAGG
AGAAAATGTCAAATTACACGGAAAAATCCACACCACTGTG
AGGCTGTGAAAGAAACTCCTGGTTCCTCCTATTGGAAGGA
GGTGGCAGAGGAAAGGAGGAAAGCCTTGTTCAGTGTTCTC
CAGGAGAATGAAAAGTTGCATAAAGACATTGAAGCCAAAG
ACGAACAGATTGCTCAGCTGAAGACTGAGAATGAAGAGTT
GCAGGAACTGGCGCAGCATGTACAACACATGGCAGACATG
ATCGAAAGATTAACTGGAAAAAGTCCAGACAATCTAGAAG
AGTTGCGTGAGATTGCCTTTGATGCTGAAGATGAGGAGTT
GGAGAATGAAAATGAAGATGAGGAAGAACATGAAGATGAG
GATCAGGAGCATGACTGTGAGGGTGAAGCTGATGAAAGTC
AAGACACT

gmnn TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gmnn-004 (1) 818
mRNA gmnn-201 (1) 1031
gmnn-202 (1) 786
aberrant processed transcript gmnn-204 808
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gmnn-204 Contained in:
OTHER gmnn-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054534 (1)
  • Ensembl_Trans:ENSDART00000151536 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT725632 (1) 812bp
    CITATIONS (2)