header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-912
Transcript Name: cdc14ab-201
Previous Names: cdc14ab-001, dkey-168j9.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020078 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020078|OTTDARG00000016695|ZDB-GENE-070705-309 cdc14ab|OTTDARP00000016964 DKEY-168J9.1-001 LG_none BX908733.16,CR751228.20 Danio rerio protein_coding NOVEL, 4436 bp
CCGTGCAACGGATCGCGATTGATTTCTGCCCGGTTTAAAG
CGAAAACGGATTTATAATACGACGCACGGTGGCTCGAAGG
CTCACGCGACGGACAAAAGCCTCCAGCGCTGCTCATTCAA
GCACTTTTACGCGGGACTCGAGATGACGCACCTTGAGTTG
TTTTAACAGCCTGGGAAGTTACAGATTTGTTTTTCTCCTC
ATCCACGCGTGGGAGAATGCCACGAGATACCAGTGCCTTA
TTTATACACCCCAGTGGGCTTTTAAATTGTTGAACTACTC
GGAATTATTTGCGCCATCAGTTCCGAGAGAAGTTGCATCC
GAAGAGAGGAAACTGGTTTTAAAGCTGTGTAGTAGTTTGT
TCTGGTTTGAAGAGTTGCTGCGCCTCCGTCGATGACTCTC
GACAACTTAAAACATTCCGCGATACTCTCCACGTTATTTA
AAATGGCTGACGATAATGATTTATTAGGGGCTTCAGAGTT
TATCAAAGATCGACTGTATTTTGCAACCTTACGAAGCAAG
CCGAAAAGCACAGCAAATACGCATTACTTCAGCACAGATG
AGGAGTTTGTGTACGAAAACTTTTATGCTGATTTTGGACC
CCTCAACCTTGCTATGCTGTACAGATACTGCTGTAAACTC
AACAAAAAGCTGAAGTCGTTTACACTGACCAGAAAGAGGA
TTGTGCACTACACCAGCTTTGACCAGCGCAAAAGGGCTAA
TGCCGCAGTGCTGATCGGCGCTTATGCTGTGATTTACCTG
AAGAAAACACCAGAAGAAGCCTACAGAGCCCTGATCTCCG
GCTCCAATGCCTCCTATCTTCCTTTCAGGGATGCTTCATT
TGGAAATTGCACATACAACCTGACGGTTCTTGACTGTTTA
CAAGGCATTAGGAAGGCCCTGCAGCATGGATTTTTGAACT
TCGAGACTTTCGATGTTAACGAATATGAACATTATGAGCG
TGTAGAGAACGGAGATCTGAACTGGATCACCCCAGGCAAA
CTTCTTGCTTTCAGTGGGCCACATCCCAAAAGTAAAGTAG
AGAACGGTTACCCTCTACATGCGCCTGAGGCATATTTCCC
GTATTTCCGCAAACACAACGTCACGACCATAGTTCGCCTC
AACAAGAAGATCTACGATGCCAAGCGCTTTACAGACGCCG
GTTTCGACCACTATGACCTGTTCTTTGTGGATGGCAGCAC
GCCCAGTGACATCATCACCCGCCGCTTCCTGCACATCTGC
GAGAGCACGAGCGGAGCGGTGGCTGTGCACTGCAAAGCGG
GTTTAGGCCGGACGGGCACTCTAATTGGCTGCTACCTGAT
GAAGCACTACCGTTTCACATCTGCCGAAGCCATCGCTTGG
ATCCGCATCTGCAGACCTGGTTCTATTATTGGACCCCAGC
AGCATTATTTAGAAGAGAAGCAGGCCAGTCTCTGGGCTCA
TGGTGATAGTCTACGGTCCAAGCAGAGGCAGTATCAGGAC
AGATCAGTGCCTCAGCTTATCTCCAGTATGGACAACCTCT
CCATCAGCACCTCCATCTTTAAATCCCACAGCTTGGACCG
GATGGAGGAGAATGATTATGCTGAGAACGATCTCGGTATG
ACGCAAGGAGACAAACTGCGTGCCTTAAAGGGTCGACGGC
AGCCGAGGTCTGCGACCACTGGAGCCATAAGAGTCGAGGA
CGTGAAGGTGCACACTAGGTCTCCATCTCAGCCTCTTAGT
CGAATGAAACCGCCTGCCTCCAGCCAGGGCTCCATCTCCC
CCCTCAAATCCTCCAAAGTCCCAGCGTCGTCCTCCTCCTC
TTCCTCCTCCTCCTCAGTCTCTGCCTCTGCCAAGCGAATC
GGCCGCTCTTCATCTTCATCCACCAACCTGAAGAGTCCCT
TCAGTCGGAGTATGTTCAGTACTAAAGCCGCCATTTTCCA
CTAACCCGTGGCGCCTTCACTGTGACCACCAATTCGGGGA
ATGAAGCTGAAAGGAGACACTTTTGAGACTGGTGTACGGT
CAACCTTGCGAGGGCTGATCTGGAGTCTGCTGCCAGCTGT
TAAATAACAAACTCGCCTTGGCCGTCCTTTTATTTTTTAT
TTTTATTTTTTTCTAAAAGGAGATTTTCCATGTATTAACA
TACATAGATGTCCTGAACAATATTTTTAAATGATTTTTGT
ACTATTTTATCTACAATTCTTATGCTCAGCATCAAGGTTT
GTTTGGTATATTAGTGTATCTGTGGATTAGGGAATTTGCT
CTGACGTAAATGTCACGTTTTTGTCTCTCTCGAGTATTTA
CCGAGTAACATATCAAGTGCGAGGGCTATTTTTGAAAGGT
GCAAAATGGTTTGACAGCTATGTGTCGCCTTCAAAGGGGA
TTTTTGGGCAGCAGAAGCGATTAAAGAGTGTTGTGTTTTC
TTCATTTGAGGTCTAAGGTGGACTCGTCTCCACGCAACAG
TGGACGGCTAATGAGACCACGACCACGATTTGCAAGCAAA
CTTTATTTTTTCCTCTCTGGAAAATGAAGGGCTTTGTTTG
TTGAGTAGGACTCAGGGTGGACTCCTTTTTATTTTACATA
TTTTTCTGTGTCGTTGTGACATCATAATGCGTGTTATTAT
CAAACTAATTCAGATCTGAGCTTTTAAAAAGCTTTAAGGG
CTGTTGAAAACGCTTCATCTTCACGAGTGTCCTTTCACCA
GCACTTCTGAAATATAACATCTCATGTACGAGTTGGTTTT
ATTAGCCAGCATTTTCTGCGAAATATGAATGATAAAGCAT
ATGAAGAAATAGCTCAATCAAAAGCTGCAACTTTCTATTA
CGGCAGTGTTTCTCAACCACGTTCCACCAACACTGCATGT
TTTGCATGCCTCCTTTGTCTGTCATACCCATTACAGATCT
TACTGTCTCTGCTGATAAGCTGGTCATCTGAATCAGGTGT
GTTTGATTAAGGAGACATGGAGCTGGTGGGACGTGGTTGA
GAAAAACTCTTACAGTACAAGAGCTTGGGTTTAGGAGATG
ATGTGAATTACAAAATCCTTCATGTTAGTGCACATAATGA
ATGTACAGCTTAATACGACTTTAAATTCGGTTCATTTAGG
ACAGGGGTGGCCAATCCTGTTCCTGGAGAGCCACCATCCT
GCAGATTTCAGTTGCTACCTATATCAAACACACCTGAACC
AATTAATTAGGACCTGAACACCACATGATAATTACAGGCA
GGTGTGTTTGATATAAGTTGCAACTGAAATCTGCAGGAAG
GTGGCTCTCCAGGAACAGGGTTGGCCATCCCTGATTTAGG
ATGTTTACGGTTATGTGCAAACAATTCATCAAACAGTGTT
TGTGTAGGTTTACCAGCAGATTTATGGAAAGAAAAACCTT
TTGATTATTTATATACATCACCAAAAAAGCACAGTAGAGT
CAATTCAACTTGAATTTATTTCGTTTGTGAAACACAAAAT
AATGTGCAAATTTACTGAGCTCTTTTTACAAAATGGGACT
GTTGAACTTCAGATGTATCATAAAAATACTGGGTTAATTT
AGTTTAAAAGACATTTTATGAAATTTTATTGCTTTAAAAT
GTACTTGGTGTGAAAATAATGAAGTAATCGCTATTCCAGT
CATTTATTTTATAAAAGCTTTTCATTATTTAAAAAAAAAA
TTCTAATTAAAACAGCTTGATCCAAATGTGAAACTGGGAA
ACTTAATAGAAATGTCATCAAATCTGGCTACAGCAGAGGC
CAAGCTTCTGTGCAAATTACAACAGTTTTATTATCATTTT
TATTATTATTTTTAATCATGTAAAGCAATTTTACGTCTTC
GTTATTATATAAATCTATTGAAATGTGACAAACCAGTTGA
TTGTGATGACAAAGTTAATGTACTCATTTACATTTGGACC
TCAACAGCCCTATTCGTTTCATTTAATGAAATAAAAAGCA
GCTCAAACACTTTGTCTAGCATCTTTTGTGTTCCACTGAG
AAAATTATAAGTCATGTATGTTTATTTTAGGCGAGTAAAT
GATGACGGTTCATTTTTGGGTTAAACCAGCCCACATGTAT
TTGAACAAATACTCCATTTTTATGCAATTGTAGCTGATTT
GACTGTTCTGTATCTGCGTATTTTAGCCCATGTAGCACTC
TGTACATTCCAGACGGTGTTATGAATAATGTATGTGTATA
TATACGTTTTGGGAGAATCTTATTTGATTGAAGTATTCTA
CCTCTTTAACATATACATGATGTAAACTACTATCTTGCTT
ATGGAAAAAAAATATACATATATATATATTTTTGGAGCAG
TGTGTAAAGAAAATCTAACAATGTTAGAGCAGTGTTTGCT
TTTCACATACTAGATGCACATTAAAATACAATGTAGTGGG
TTGTACATTACTCTATTTTTCAATGTAAACATGATTTTGA
AGAGCCGAATGAAAATAAAAGACAAATTTTGCTTTA

cdc14ab TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cdc14ab-201 4436
cdc14ab-202 (1) 510
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdc14ab-201 Contained in:

OTHER cdc14ab-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000020078 (1)
  • Ensembl_Trans:ENSDART00000105681 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT632460 (1) 813 bp
    GenBank:DR727684 (1) 748 bp
    GenBank:EB892701 (1) 592 bp
    GenBank:AW826966 (1) 584 bp
    GenBank:CT604021 (1) 567 bp
    GenBank:AL908455 (1) 538 bp
    GenBank:AL908456 (1) 537 bp
    GenBank:BG729477 (1) 507 bp
    GenBank:AL921944 (1) 503 bp
    GenBank:CD587269 (1) 345 bp
    CITATIONS (2)