header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-9
Transcript Name: mapk1-203
Previous Name: mapk1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018991 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018991|OTTDARG00000015839|ZDB-GENE-030722-2 mapk1|OTTDARP00000016030 mapk1-002 LG_ BX005237.6 Danio rerio protein_coding KNOWN, 1411 bp
GCTCGGAGCCACGCGCACGTTAATTTACTATCAGCAGAAA
ATATATGCCTGTCAACAGCATTTCAGCCGCTGCTCTCCAA
CACCGAGTCTTCGGTTCAGTTTAAAAGCGTCGCTTTTCGC
CGTGTTTCACTCTACCTAAGAGCTTTTCCTGGTGCTTTTG
GGTGAGAAAAGCGCGTTTGTTTTGCTTGTGAAGGCAGCTT
CAGTTTCTCAGCAATGGCGACAGCTGCGGTTTCTGCCCCT
GCTGGCGGCGGCCCGAACCCCGGATCCGGTGCCGAGATGG
TCCGCGGGCAGGCTTTCGATGTCGGGCCGCGTTACAGCAA
CCTCTCCTACATCGGAGAAGGCGCTTACGGCATGGTTTGT
TCAGCATATGACCGTGACAATAAAGTACGTGTGGCGATCA
AGAAGATCAGCCCGTTTGAGCACCAGACGTACTGTCAGCG
CACACTGCGTGAGATTAAAATCCTGCTCCGCTTCAAGCAT
GAAAACATCATCGGTATCAACGACATCATCCGCACGCCCA
CCATCGACCAGATGAAAGACGTTTACATCGTACAGGACCT
GATGGAGACAGACTTGTACAAGCTGTTGAAGACGCAGCAC
TTGAGCAATGACCACATCTGTTACTTCCTGTATCAGATCC
TGCGCGGCCTGAAGTACATCCACTCCGCAAACGTTCTTCA
CCGAGACCTGAAGCCATCAAACCTGTTGCTCAACACTACC
TGTGACCTCAAGATCTGTGATTTTGGGCTCGCTCGGGTGG
CTGATCCAGATCATGACCACACCGGCTTCCTGACGGAGTA
TGTAGCCACACGTTGGTACCGCGCACCAGAAATTATGCTC
AATTCTAAGGGTTACACTAAATCCATTGATATATGGTCTG
TTGGTTGTATTCTGGCTGAGATGCTTTCAAATAGACCCAT
CTTCCCCGGGAAACACTATCTGGACCAGCTTAACCACATC
TTAGGTATTTTGGGCTCCCCTTCTCAGGAGGACCTGAACT
GCATCATCAACATTAAAGCAAGAAATTACCTGCTGTCCCT
TCCTCTCCGCAGCAAAGTGCCCTGGAACCGCCTGTTTCCC
AACGCAGACCCTAAAGCGCTGGACCTGTTGGATAAGATGT
TGACCTTTAACCCCCATAAGAGGATTGAGGTGGAGGAAGC
GCTCGCTCACCCGTACCTGGAGCAGTACTATGATCCTACA
GATGAGCCTGTTGCTGAGGCTCCGTTCAAGTTCGACATGG
AGCTGGATGATTTGCCCAAAGAGACTCTGAAAGAGCTGAT
CTTTGAAGAAACCGCACGCTTCCAGCCAGGCTACAGACCA
TAGCTGTGCACACAGGTAAACCACAGAGTAAATGCAGGAT
TACAAAATGACCAACAAAATCAAGAGCATCATATAATGAA
CAAAAAAAAAA

mapk1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mapk1-003 (1) 904
mRNA mapk1-201 (1) 1641
mapk1-203 1411
aberrant processed transcript mapk1-204 (1) 607
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mapk1-203 Contained in:
OTHER mapk1-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000018991 (1)
  • Ensembl_Trans:ENSDART00000149700 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AB030903 (1) 1441bp
    CITATIONS (2)