ZFIN ID: ZDB-TSCRIPT-110325-855
Transcript Name: dnajc5ab-201
Previous Names: dnajc5ab-001, ch211-195i16.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050969 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050969|OTTDARG00000035785|ZDB-GENE-081021-2 dnajc5ab|OTTDARP00000040057 CH211-195I16.6-001 LG_ BX649300.4 Danio rerio protein_coding NOVEL, 823 bp
GATCATAAGACCAGGACGCGTATAATCGAGCACCGTGTGT
GTATTTCCCTGTTTCCGAAGGCCATTTAACCATATAGGAA
AGCATTTCAGAAGAACCGAAGATCTGCACACGACCTGCGT
TTCTCTCTTTGACGAAAGAGGAGGTGGTTGTTGGTGTGAG
GGGAGAGAGAGTGTGTGTGTGTGTGTGTGTGTGTGTGAGT
GTGTGTGCGCGTGTGTGTGAGTAATGGCGGAGCAGCAAAG
GCAGCGAGCGCTCTCCACGTCAGGAGAATCGCTATATGTG
GTGCTGGGGGTCGAGAAGAACACTGCACAAGAAGACATAA
AGAAATCCTACAGAAAACTTGCTCTGAAATTCCACCCGGA
CAAGAATCCCAACAATCCAGAAGCTGCTGATAAATTTAAA
GAAATCAACAACGCTCATGCTATTCTGTCAGACCCCACCA
AACGCAATATTTATGACAAATACGGCTCTCTGGGCCTCTA
CGTGGCAGAACAATTCGGAGAGGAGAATGTTAACACATAC
TTTGTATTGTCCAGCTGGTGGGCCAAGGCGCTGTTTATAT
TCTGCGGTGTGGCCACGGGCTGTTATTTCTGCTGCTGTCT
GTGCTGCTGTTGTAATTGCTGCTGTGGGAAGTGTAAACCT
CATCCTCCTCACTCAGATGATCCTGATTTCTACGTGTCTC
CTGAAGACTTGGAAGCTCAGATGCAGTCTGATGAGAGAGA
CGGCAGCAGCCCTATCATGATGCAGCCGTCCTCTGCCACA
GAAAGCACTCAGCTGACCGCAGACTCTCACCACACCAGCT
ACCGGACAGACGCCAACTATTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnajc5ab-201 Contained in:
[BAC] CH211-195I16 (1)

Genome Resources: Vega_Trans:OTTDART00000050969 (1),  Ensembl_Trans:ENSDART00000148423 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL914683 (1) 537 nt
GenBank:CB351957 (1) 447 nt
GenBank:AL914681 (1) 441 nt
CITATIONS (2)