ZFIN ID: ZDB-TSCRIPT-110325-831
Transcript Name: ankrd1b-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050857 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050857|OTTDARG00000035707|ZDB-GENE-070820-13 ankrd1b|OTTDARP00000039936 ankrd1b-001 LG_none CU607074.5,CU611047.5 Danio rerio protein_coding KNOWN, 1348 bp
CACCACTACATATATAAGTGATGCTCCATCAGAAGCATTC
ATTTTAACACAAAGAGTTTTCAAGAAAAATCATGGGAATC
CTGCAGGTCGAAGAGCTGGTTACAGACATCACAGGTGGAA
ACACAGATCAGGACACCACTGTACAGAAACGTCCATCTGA
AGAATGCAAGAGCTCTGCTGACCATCATCTGAAACCCTAC
AACAACCTTCAGTGTGAGGGTGAAGTCATTCTCAGCGGCC
TTGATACTGACAACAGCACTAATGACCTCCAGGTTGTGAA
AAACAGTGTGCAGACAGAAGTCTACAAAAAACAGCCCAAA
CAAGAGCTAGTGAATGATTTTGTGGATGAAGATGACTTCC
TGAAGGCAGCGCTGGATAATAAATTGCCAATGATCAAAAG
TTACCTCGCCAGAGGTGCAGACCCAAATGCATGTGATAAT
TTCAATCGTACAGCTCTACACAGAGCTTGCTCACAAGGAA
ACGTGGAAATTGTGAACGCACTTCTGGAAGCTGGTGCTTC
AATAGGAAATAAAGACAAGCTTCAAGCAACTGAAGTCCAC
TGGGCTTGTCGTGGAGGTAGTTTGCCTGTGCTGGAGGCAC
TACTTAATCACGGGGCAAACCTGGATGCCAGAGACAAGCT
TCGCAGCACTGCTCTTCATGTGGCGGTCAAGACAGGACAC
TACGAATGTGCTGAACATCTCATCCACTGTGGCGCAGATG
TCAACGCAAAAGACATAGAGGGTGACACGCCATTGCACGA
CGCAGTCAGCCTGAATCGTTTCAAACTCATCCAGCTTCTT
CTACTGCACGGAGGGGACTTACATATCAAGAACTTTGAGG
GAAAGTCACCTATGGACAAGGTGTGTGAGTGGCAGAATGG
AGCAAAATCAATCTTTGACAACTTTCAAGACAATAAAAAA
TAAATGCATCACATGACCACCTGGACAACTCTGGGCTTAA
TATCATCCAAATAAACTATTATGAGATATTATGAGCCTGC
ATATTAAAATCTAATATGTGAAGAAGATATATTATTGAGT
TATAAGAATGTTTTGAGAGTTTTGGCAAAGCACTTCAACT
TTTTTATTATTAAATTATAGAGAAAACAGAAAGGAATGCG
AAGCCTAAATAAATATCGTCTTCTTTTGTTGACATGGGAA
TACAAATGAAACTGCTGAAATTAAATCATGAATGATAGGT
GTGATTTGATATTCCAAAACTTTATTACAGAATGTGCTTT
TTGTGCATGACGTCTGTACAGAATATGACATAAGAATTTT
TGTACTATTATATGTAAATTTTGCTTGCAATTCCATTAAA
CCTTAACTAATAAAATACATTTTTAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ankrd1b-001 Contained in:
OTHER ankrd1b-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050857 (1)
  • Ensembl_Trans:ENSDART00000113810 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC150367 (1) 1327bp
    GenBank:CK684199 (1) 897bp
    GenBank:CK679085 (1) 816bp
    GenBank:CK693370 (1) 608bp
    GenBank:EB864714 (1) 526bp
    CITATIONS (2)