ZFIN ID: ZDB-TSCRIPT-110325-750
Transcript Name: sfrp5-201
Previous Name: sfrp5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050471 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050471|OTTDARG00000035464|ZDB-GENE-011108-2 sfrp5|OTTDARP00000039621 sfrp5-001 LG_ CU695206.7 Danio rerio protein_coding KNOWN, 1976 bp
ACACACTAGGTGCACTTCAGTCAAACTAGACAAGAGCTCT
GCTGCAGTTTCTGTTAAACCACAGGACAGAAGCAGAAAAG
GAGGGAAACCCCAGATTTTTATTTTATTTCTTAAACACAA
CAAAAAAAAAGGATTAACATTTAGATTTTGAAAATTTTGA
TTTACACTTACCCCCCCGTTCTCCTGAATCACAGCAGAGG
ATGGCGGAGCTGAAGAGGCAGGTGTCTCTGACCCAGGCTG
TGACCCTGGCGCTGGTTCTACTCACTTCAGCCTCTTCGGC
AGAGGAGTACGACTACTACAGCTGGCAGTCGGACAATTTC
CACAGCGGCCGCTTCTATGCCAAGCAGCCGCAGTGTGTGG
ATATCCCAGCCGACCTGCGGCTCTGCTACAACGTGGGCTA
CAAAAAGATGCGCCTGCCAAACCTATTGGACCACGAGACC
ATGCCTGAGGTCAAGCAGCAGGCTGGCAGCTGGGTGCCGC
TTCTAGCAAAGCGATGCCACGCTGACACGCAGGTGTTCCT
CTGCTCACTGTTTGCTCCGGTGTGCCTGGACCGGCCCATC
TACCCCTGCAGGTCTCTGTGTGAGGCGGTGCGGGACAGCT
GCGCCCCGGTCATGGAGACCTACGGCTTTCCCTGGCCGGA
GATGCTACAGTGTGAGAAGTTCCCCATCGATAATGATCTA
TGCATTCCTATGCAGTTCTCCGCAGGACACGTCACTCAGA
CTCCAGTTTCCAAAGTGTGTCCACCCTGTGACAACGAGTT
GAAAGCCGACACCATAATGGAGCACTACTGCGCCAGTGAT
TTTGCACTCAAGATGAAAATTAAAGAGGCGAAAAAGGAAA
AAGGCGACCGCAAGCTCATCGCAGCGCAAAAGAAAAAGAA
GGTTCTGAAAATGGGAATACTGAGAAAGAAAGACCTAAAG
AAGCTCACTCTATACATCAAGAATGGAGCCAACTGCCCCT
GCTCACAACTGGACAACCTAGGGAGCAACTTCCTTATCAT
GGGCCGCAAAGTAGACCAGCAGCTACTGCTCATGTCCATC
CACAAGTGGGACAAAAAGAGCAAGGAACTCAAGTTTGCCA
TTAAATACATCAAGTCTCAGCAGTGTCCCACCTATCACAG
TGTCTTCCAGTGACCAATGACTTTTTGGTGGTCTTCCAAT
AACTCTTTCAGAGACTGTATCCATGCCTAATTCCGACCAT
TAGTACAGATGTATTTTATAACTCAAGAAACGGCTTTTGG
AAACTGCTTAGGACTTAATCCATCATCAAGTACAGCTACG
TTCTGTTGGCAACTGTATCTGCATAAAAAGTTATTGTTTA
TGAAGCAATCAGCACACTTACGATACTCATGCATATATTT
TAGGGAAACTTTCCTGTTTCAGACTACAGGGTTTTTTTTT
TTTTTTTTTTGGAAAGACATTGACGACCCTTTCAATCAAC
ATGAGAAAGAAAATTGTGAACAAAAGCTTTAAAGTTAATG
AGCACATATTTGATTTCAGTGGCCAGATTCCATTTAAAAG
AGTGAAAAAAGAGCAAACATGGTGCCAACTGGGTTTTATT
TGTATCTTCTATTTTGTAGATAAGGAATAAAAAGTTTTTA
TTATATACCACATTGACACAATCGTGATCATTAGCACCAG
ATTGAGACATAAGTCGGGTTGTGGCTTGAATCTTGGGAGG
TAAGACAGCTGATGGATTGAAAAGTGTTGGTCAGGATGGC
AGCCCAAATACATCAACCGCAGGCCAGTGAGCAAGTCTGG
ACAATATCATATTGGCCGAGCTCATGACAGACTATGGACT
CGTTCGAGCAGTTTGGTTGGTGAGGTGTTTCTATTCTGCT
TTCTATACAGTATGCAACTGTGTTTTCTTTTTTACTAAAG
TTATTATATATTGCTACAAACCTATGTACAGTACATGGTA
TGAAAAGAGCCTTCCAACATTTCATCTGACTGTAATAAAG
GATAACATTTAACTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sfrp5-201 Contained in:
OTHER sfrp5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050471 (1)
  • Ensembl_Trans:ENSDART00000056996 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC085455 (1) 2006bp
    GenBank:AY050560 (1) 1846bp
    GenBank:BC164265 (1) 1000bp
    CITATIONS (2)