header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-691
Transcript Name: mif4gdb-201
Previous Name: mif4gdb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050207 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050207|OTTDARG00000035296|ZDB-GENE-050227-7 mif4gdb|OTTDARP00000039410 mif4gdb-001 LG_ CU855820.5 Danio rerio protein_coding KNOWN, 1387 bp
ATTAATAAGTCAAGACGCTGAGAGAGTCTGGCTGGTTGGA
GCTCGAGACAAATCCGCTGGAGAAAGAGCGAGGAAGGAGA
GATATGTGAACATATCTGCTTGTTTGAGTCTCCTGTTACT
TTTAAAATGGAGAACTCCTCCAAAGAAGACTACAAGATCC
AGTCATTTGATTTAGAGACTCAGAAACTTCTCAAAACTGC
CTTGAAAGACCCAGGATCTGTTGACCTAGAGAAAGTGTCC
AGTGTAATAGTGGACCAGTCTCTGAAGGACCAGGTCTTCA
GCAGGGAGGCCGGACGCATCTGTTACACCATTGTCCAGGC
GGAGGCCAAACAGACGAACGGGAGTGTGTTTCGGCGTAAT
CTGCTCAATCGACTGCAGCAGGAGTTTAAAGCCAGAGAAG
AGACGAGAAAGAGGTCGACTCAGGAGTGGGTTTGTCTCGT
GTCCTTCATCTGCAACATCTTCGACTACCTCAAGGTCAAC
AACATGCCCATGGTGGCTCTGGTCCACCCGGTCTATGACT
GTTTGTTCAGACTGGCCCAGTCAGATGCCCTGAAGAATGA
AGAGGAGGTGGACTGTCTGGTGCTGCAGCTTCACCGTATT
GGAGATCAGCTTGAGAAGATGAATGTTCAGCTCATGGACG
AGCTCTTCAATCTGCTGCGGGATGGGTTTCTCCTGCAGGA
GGATCTGAGCTCCATGGGGCGCCTGCTTCTGCTGGAGATC
CTGGAGTTTCGTGCTGGAGGCTGGAAGCTCAGCGACACAG
CTCAGAAATACTACTACAGTGAAGTGACGGACTGAGGCTC
CACCAATCAGCAATCAGTGGAACATGAAGACATTGGAACC
AAGGATGGAGGTTTCATTTTTAAGATTAAAGAGATTGCAC
TTGTTATGCTTTCAATCCACTTGATTCAAACATGTTTGGT
GAACAAATTAACAATATTATTATTTTTTTCTACTATAGCA
GCTGGTGTCCAACATACTTTAAAATATCTTTCTTTTGTGT
TTAACAGAAGAAAAGAAATCAAAGTTGGAATCACAAGACG
GAGAGTAAATCTTGAGTAAATGTTCATTTTGGAGTAAATT
ATCTCTAAGGTTGCATTTACACTGCAGGCCTTGATGGTCA
TTGCCAGTTTATGACTGGATCAGATTTTTTTGATGACCCA
CTTACATCATCTTTTAAAAGTGACTCATATCCAGTCTGGT
TTATGCTTCTGCCTCGAGTGATCGACGTGACTCATGGCGC
ATGGCTTGTGCATTACTGTGCATTTATACTTCTGCATGCT
GTTTCTGTTGCTCTGCAATACAATACCGAAAAGCTAGTTG
ACAGTGAGGTTGTGTCGAGTTTCTTTGCTGGTGTTTTGTT
TTTTTCTGAACGCTTCCTTAATATACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mif4gdb-201 Contained in:
[BAC] CH73-56L3 (1) (order this)

OTHER mif4gdb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050207 (1)
  • Ensembl_Trans:ENSDART00000168938 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090306 (1) 1420 bp
    GenBank:EH568992 (1) 868 bp
    GenBank:EH536085 (1) 846 bp
    GenBank:CO356133 (1) 560 bp
    CITATIONS (2)