header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-671
Transcript Name: mapk1-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050133 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050133|OTTDARG00000015839|ZDB-GENE-030722-2 mapk1|no_translation mapk1-003 LG_ BX005237.6 Danio rerio protein_coding KNOWN, 904 bp
AGTCAGTCAGTCGGTGAGTCGGTGCTCGGAGCCACGCGCA
CGTTAATTTACTATCAGCAGAAAATATATGCCTGTCAACA
GCATTTCAGCCGCTGCTCTCCAACACCGAGTCTTCGGTTC
AGTTTAAAAGCGTCGCTTTTCGCCGTGTTTCACTCTACCT
AAGAGCTTTTCCTGGTGCTTTTGGGTGAGAAAAGCGCGTT
TGTTTTGCTTGTGAAGGCAGCTTCAGTTTCTCAGCAATGG
CGACAGCTGCGGTTTCTGCCCCTGCTGGCGGCGGCCCGAA
CCCCGGATCCGGTGCCGAGATGGTCCGCGGGCAGGCTTTC
GATGTCGGGCCGCGTTACAGCAACCTCTCCTACATCGGAG
AAGGCGCTTACGGCATGGTTTGTTCAGCATATGACCGTGA
CAATAAAGTACGTGTGGCGATCAAGAAGATCAGCCCGTTT
GAGCACCAGACGTACTGTCAGCGCACACTGCGTGAGATTA
AAATCCTGCTCCGCTTCAAGCATGAAAACATCATCGGTAT
CAACGACATCATCCGCACGCCCACCATCGACCAGATGAAA
GACGTGTATCCTTTCAAAAGCAGTGTGAAGATGTTGAGAC
TGCAGAAGCAGTGGAATGTTTGGACATGAAGTGACTAATA
TTAGAACGTTTATTCATTTAATCACTAAGCAGATGCTTTT
ATCCAAAGAGACTTACAAATGTGGACAAAAGAAGTAATCA
ATATATAGTATATATCACAGAGACGCACACTGGAGAGAGA
GGTTTTGTTGATAGGTTAGATTTTAAGGCAAAATAGAATA
GAATGGAAGCTGAATAAATATATATACATGTTGTTTAGAT
GAAAAATTTAGATGATAAAGTTATTGTGATTAGAAAGTGA
TTTTTTTTTTTATTTATAAATAAA

mapk1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mapk1-003 904
mRNA mapk1-201 (1) 1641
mapk1-203 (1) 1411
aberrant processed transcript mapk1-204 (1) 607
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mapk1-003 Contained in:

OTHER mapk1-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050133 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH432238 (1) 913bp
    CITATIONS (1)